Login to display prices
Login to display prices
ELMOD1-ELMO/CED-12 domain containing 1 Gene View larger

ELMOD1-ELMO/CED-12 domain containing 1 Gene

PTXBC028725

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELMOD1-ELMO/CED-12 domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELMOD1-ELMO/CED-12 domain containing 1 Gene

Proteogenix catalog: PTXBC028725
Ncbi symbol: ELMOD1
Product name: ELMOD1-ELMO/CED-12 domain containing 1 Gene
Size: 2ug
Accessions: BC028725
Gene id: 55531
Gene description: ELMO/CED-12 domain containing 1
Synonyms: ELMO domain-containing protein 1; ELMO/CED-12 domain containing 1; ELMO domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaatcgaaacatcactgagggattctaaaagtaagctgttgcagacttctgtgagtgttcaccccgacgctattgaaaaaactatagaagatatcatggaactgaaaaaaattaatcctgacgtaaatccacagctgggaatctctcttcaggcttgccttctgcaaatcgttgggtacaggaaccttattgcagatgtggaaaaactgcgtagagaggcctatgattctgataatccccaacatgaagaaatgcttttgaagttatggaaattcttgaagcccaatactccactggaatctcggatttctaagcagtggtgtgaaattggtttccaaggtgatgatcctaaaacagactttcgaggaatgggacttctgggactgtacaatttgcagtatttcgcggaaagggatgccacagcagctcagcaggtcctgtctgactctcttcatccgaaatgcagggatatcactaaagaagaaataagcaaattcagcaaagcagaatgggagaagaaaaggatggataaggcaattgggtactcatttgcaattgtgggcatcaatataactgacctggcatataatctactggtcagcggagctctaaaaacccatttctacaatatcgccccagaagctccaacattgtctcactttcagcaaacattctgctatttgatgcatgaatttcataagttttggatcgaagaggaccccatggacataatggaatttaatcgtgtgagggagaaattccgcaagaggatcatcaaacagctgcagaacccagacatggcgctgtgcccacattttgctgcctcggaaggtttaatcaacatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: