ELMOD2-ELMO/CED-12 domain containing 2 Gene View larger

ELMOD2-ELMO/CED-12 domain containing 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELMOD2-ELMO/CED-12 domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ELMOD2-ELMO/CED-12 domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015168
Product type: DNA & cDNA
Ncbi symbol: ELMOD2
Origin species: Human
Product name: ELMOD2-ELMO/CED-12 domain containing 2 Gene
Size: 2ug
Accessions: BC015168
Gene id: 255520
Gene description: ELMO/CED-12 domain containing 2
Synonyms: 9830169G11Rik; ELMO domain-containing protein 2; ELMO/CED-12 domain containing 2; ELMO domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttatttctttgtgggagttcttctatgggcacttttttcgattttggatgaaatggctattacgacagatgactgggaagtgtgaattgcagcgaatatttgatacctatgtaggtgcacaaaggacacacaggatagaaaattccttgacatactccaagaataaggttttacagaaggcgacacatgttgttcagagtgaagtggacaaatatgtagatgatattatgaaggaaaagaatattaaccctgagaaggatgccagttttaaaatatgcatgaagatgtgcttactgcagataactggttataaacagctgtatttggatgtagaaagtgtgaggaaaaggccatatgattctgataacctacagcatgaagagctactcatgaagctttggaatcttctaatgcccacgaagaagttaaacgctagaatctccaagcagtgggctgaaattggttttcagggtgatgatcccaagacagacttcagaggcatgggcatacttgggttaatcaatcttgtgtatttcagtgaaaattacactagtgaagctcatcagattctttcccgttcaaatcatccaaaattagggtattcttatgcaatagttggaatcaatcttacagagatggcttatagcttactgaagagtgaagctttgaagtttcatctctataaccttgttcctggtataccaacaatggaacactttcatcagttttactgttatcttgtctatgaatttgacaagttttggtttgaagaagaaccagaaagcattatgtatttcaatttgtatagagagaagtttcatgaaaagattaaaggacttttactggattgtaatgtagcacttactttaaaagtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - retinal G protein coupled receptor
- polymerase (DNA directed), lambda
- peroxisomal biogenesis factor 19
- peroxisomal biogenesis factor 26

Buy ELMOD2-ELMO/CED-12 domain containing 2 Gene now

Add to cart