PEF1-penta-EF-hand domain containing 1 Gene View larger

PEF1-penta-EF-hand domain containing 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEF1-penta-EF-hand domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PEF1-penta-EF-hand domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002773
Product type: DNA & cDNA
Ncbi symbol: PEF1
Origin species: Human
Product name: PEF1-penta-EF-hand domain containing 1 Gene
Size: 2ug
Accessions: BC002773
Gene id: 553115
Gene description: penta-EF-hand domain containing 1
Synonyms: ABP32; PEF1A; peflin; PEF protein with a long N-terminal hydrophobic domain; penta-EF-hand domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagctatccttaccggcagggctgcccaggagctgcaggacaagcaccaggagcccctccgggtagctactaccctggaccccccaatagtggagggcagtatggtagtgggctaccccctggtggtggttatgggggtcctgcccctggagggccttatggaccaccagctggtggagggccctatggacaccccaatcctgggatgttcccctctggaactccaggaggaccatatggcggtgcagctcccgggggcccctatggtcagccacctccaagttcctacggtgcccagcagcctgggctttatggacagggtggcgcccctcccaatgtggatcctgaggcctactcctggttccagtcggtggactcagatcacagtggctatatctccatgaaggagctaaagcaggccctggtcaactgcaattggtcttcattcaatgatgagacctgcctcatgatgataaacatgtttgacaagaccaagtcaggccgcatcgatgtctacggcttctcagccctgtggaaattcatccagcagtggaagaacctcttccagcagtatgaccgggaccgctcgggctccattagctacacagagctgcagcaagctctgtcccaaatgggctacaacctgagcccccagttcacccagcttctggtctcccgctactgcccacgctctgccaatcctgccatgcagcttgaccgcttcatccaggtgtgcacccagctgcaggtgctgacagaggccttccgggagaaggacacagctgtacaaggcaacattcggctcagcttcgaggacttcgtcaccatgacagcttctcggatgctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 1
- ELMO/CED-12 domain containing 2
- retinal G protein coupled receptor
- polymerase (DNA directed), lambda

Buy PEF1-penta-EF-hand domain containing 1 Gene now

Add to cart