Login to display prices
Login to display prices
CDCA5-cell division cycle associated 5 Gene View larger

CDCA5-cell division cycle associated 5 Gene

PTXBC011000

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDCA5-cell division cycle associated 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDCA5-cell division cycle associated 5 Gene

Proteogenix catalog: PTXBC011000
Ncbi symbol: CDCA5
Product name: CDCA5-cell division cycle associated 5 Gene
Size: 2ug
Accessions: BC011000
Gene id: 113130
Gene description: cell division cycle associated 5
Synonyms: SORORIN; cell division cycle-associated protein 5; p35; cell division cycle associated 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgggaggcgaacgcggtccggaggagccgctcagcgctccgggccaagggccccatctcctactaagcctctgcggaggtcccagcggaaatcaggctctgaactcccgagcatcctccctgaaatctggccgaagacacccagtgcggctgcagtcagaaagcccatcgtcttaaagaggatcgtggcccatgctgtagaggtcccagctgtccaatcacctcgcaggagccctaggatttcctttttcttggagaaagaaaacgagccccctggcagggagcttactaaggaggaccttttcaagacacacagcgtccctgccacccccaccagcactcctgtgccgaaccctgaggccgagtccagctccaaggaaggagagctggacgccagagacttggaaatgtctaagaaagtcaggcgttcctacagccggctggagaccctgggctctgcctctacctccaccccaggccgccggtcctgctttggcttcgaggggctgctgggggcagaagacttgtccggagtctcgccagtggtgtgctccaaactcaccgaggtccccagggtttgtgcaaagccctgggccccagacatgactctccctggaatctccccaccacccgagaaacagaaacgtaagaagaagaaaatgccagagatcttgaaaacggagctggatgagtgggctgcggccatgaatgccgagtttgaagctgctgagcagtttgatctcctggttgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: