Login to display prices
Login to display prices
FLJ20433-hypothetical protein FLJ20433 Gene View larger

FLJ20433-hypothetical protein FLJ20433 Gene

PTXBC039252

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLJ20433-hypothetical protein FLJ20433 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ20433-hypothetical protein FLJ20433 Gene

Proteogenix catalog: PTXBC039252
Ncbi symbol: FLJ20433
Product name: FLJ20433-hypothetical protein FLJ20433 Gene
Size: 2ug
Accessions: BC039252
Gene id: 54932
Gene description: hypothetical protein FLJ20433
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttttcaaagtgcaacaccccagctagcagggcccctggaacagcctcggcgccccctggaacactaatggccctccctggaacagacacggcacccccaccgagaacagcctcggtgccccctggaacagcctcagcaccccctggaacactaatggccctccctggaacagacacggcacccccaccgagaacagcctcggtgccccctggaacagcctcagcaccccctggaacactaatggccctccctggaacagatacggccccccgccagaacagacatggtgcccgctggaacactaatggtcctccctggaacagcctcggtgccccctggaacactaatggccctccctggaacagacacggcgcccccccacagaacagcctcgatgccccctggaacagcctcggtgccccctggaacagcctcggtgccccctggaacagcctggtgctcctggaacagacacagcccccccagaacagacacagcaccccctggaacagcctggcgcttcctggaatggccacatccccccatcctttctgtgctgctttaggcatctgcccttacatggttcgtgtccagctctgtcaacaaggccagctccacaagaggccccagctcagccctccccagtgggctcccctactcaggctctgggtcagcttcttcccaggaggtgtcctggcccatgtgctggccccgcctcgctgcctggacacctgtccgtgccaccctggtcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: