Cart 13 Product Products 1 504,08 € (empty)
-
1 x NFKBID-nuc...121,50 € -
1 x PEMT-phosp...113,40 € -
1 x IFI30-inte...113,40 € -
1 x CHRNB3-cho...121,50 € -
-
1 x OBFC1-olig...121,50 € -
1 x GOSR1-golg...113,40 € -
1 x PMAIP1-pho...113,40 € -
1 x NCR3-natur...113,40 € -
1 x ANKRD54-an...121,50 € -
1 x GADD45B-gr...113,40 € -
-
No products
To be determined Shipping
1 504,08 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 504,08 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 504,08 €
Data sheet of FLJ22662-hypothetical protein FLJ22662 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ22662-hypothetical protein FLJ22662 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000909 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ22662 |
| Origin species: | Human |
| Product name: | FLJ22662-hypothetical protein FLJ22662 Gene |
| Size: | 2ug |
| Accessions: | BC000909 |
| Gene id: | 79887 |
| Gene description: | hypothetical protein FLJ22662 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggcagatagtggcaagaggtgggcagacatcttttcaaaatacaactctggcacctataacaatcaatacatggttctggacctgaagaaagtaaagctgaaccacagtcttgacaaaggcactctgtacattgtggagcaaattcctacatatgtagaatattctgaacaaactgatgttctacggaaaggatattggccctcctacaatgttcctttccatgaaaaaatctacaactggagtggctatccactgttagttcagaagctgggcttggactactcttatgatttagctccacgagccaaaattttccggcgtgaccaagggaaagtgactgatacggcatccatgaaatatatcatgcgatacaacaattataagaaggatccttacagtagaggtgacccctgtaataccatctgctgccgtgaggacctgaactcacctaacccaagtcctggaggttgttatgacacaaaggtggcagatatctacctagcatctcagtacacatcctatgccataagtggtcccacagtacaaggtggcctccctgtttttcgctgggaccgtttcaacaaaactctacatcagggcatggcagaggtctacaactttgattttattaccatgaaaccaattttgaaacttgatataaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ25770 - mitochondrial tumor suppressor 1 - brain-derived neurotrophic factor - cell division cycle associated 5 |