Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MTUS1-mitochondrial tumor suppressor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MTUS1-mitochondrial tumor suppressor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033842 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MTUS1 |
| Origin species: | Human |
| Product name: | MTUS1-mitochondrial tumor suppressor 1 Gene |
| Size: | 2ug |
| Accessions: | BC033842 |
| Gene id: | 57509 |
| Gene description: | mitochondrial tumor suppressor 1 |
| Synonyms: | ATBP; ICIS; MP44; MTSG1; microtubule-associated tumor suppressor 1; AT2 receptor-binding protein; AT2 receptor-interacting protein; AT2R binding protein; angiotensin-II type 2 receptor-interacting protein; erythroid differentiation-related; mitochondrial tumor suppressor gene 1; transcription factor MTSG1; microtubule associated tumor suppressor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaattgcaagagcagtttgacaacttaaatgctgcgcatgaaacctctaagttggaaattgaagctagccactcagagaaacttgaattgctaacgaaggcctatgaagcctccctttcagaaattaagaaaggccatgaaatagaaaagaaatcgcttgaagatttactttctgagaagcaggaatcgctagagaagcaaatcaatgatctgaagagtgaaaatgatgctttaaatgaaaaattgaaatcagaagaacaaaaaagaagagcaagagaaaaagcaaatttgaaaaatcctcagatcatgtatctagaacaggagttagaaagcctgaaagctgtgttagagatcaagaatgagaaactgcatcaacaggacatcaagttaatgaaaatggagaaactggtggacaacaacacagcattggttgacaaattgaagcgtttccagcaggagaatgaagaattgaaagctcggatggacaagcacatggcaatctcaaggcagctttccacggagcaggctgttctgcaagagtcgctggagaaggagtcgaaagtcaacaagcgactctctatggaaaacgaggagcttctgtggaaactgcacaatggggacctgtgtagccccaagagatcccccacatcctccgccatccctttgcagtcaccaaggaattcgggctccttccctagccccagcatttcacccagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - brain-derived neurotrophic factor - cell division cycle associated 5 - hypothetical protein FLJ20433 - chloride intracellular channel 4 |