FLJ25770-hypothetical protein FLJ25770 Gene View larger

FLJ25770-hypothetical protein FLJ25770 Gene

PTXBC035224

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLJ25770-hypothetical protein FLJ25770 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ25770-hypothetical protein FLJ25770 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035224
Product type: DNA & cDNA
Ncbi symbol: FLJ25770
Origin species: Human
Product name: FLJ25770-hypothetical protein FLJ25770 Gene
Size: 2ug
Accessions: BC035224
Gene id: 339965
Gene description: hypothetical protein FLJ25770
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatcaaaagcttgggaatcaaataatgaagatcttttatcaagtagtggtgtcacatctaatggaggttcttcaagttcattttttgtgtcatctattcgtggtacaataattgaaaacacatcttcagctgggactttgacacaggttccttttttccctaaatatgaagtggaacttgattctcctagaaaaatcatcccatctcctggaaaggaacactttgaacgtgttttggaagaatattcacatcaagtcaaagatttacagagaagactaaatgaaagcaatgaattgcatgagaaacaaaagttttatttgaggcagtcagtcattgatttgcaaacaaaacttcaggagatgcaaatggagagagatgctatggctgacatcagacgaagggagagtcagtcccaggaggatttaagaaatcagcttcaaaatacagttcatgaacttgaagctgccaaatgccttaaagaggacatgctgaaagacagcaacacacagatagagcaactacgaaaaatgatgcttagtcatgagggagtgcttcaagaaatccggtcaatcctagttgactttgaagaagcctcaggcaaaaaatatgtgaacatgacagcatgtctactctgcacttccgcagcttgggctcagctattagtaaaatactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial tumor suppressor 1
- brain-derived neurotrophic factor
- cell division cycle associated 5
- hypothetical protein FLJ20433

Buy FLJ25770-hypothetical protein FLJ25770 Gene now

Add to cart