Cart 2 Product Products 516,50 € (empty)
-
1 x OSGIN1-oxi...121,50 € -
No products
To be determined Shipping
516,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 516,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 516,50 €
Data sheet of RBBP9-retinoblastoma binding protein 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBBP9-retinoblastoma binding protein 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015938 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBBP9 |
| Origin species: | Human |
| Product name: | RBBP9-retinoblastoma binding protein 9 Gene |
| Size: | 2ug |
| Accessions: | BC015938 |
| Gene id: | 10741 |
| Gene description: | retinoblastoma binding protein 9 |
| Synonyms: | BOG; RBBP10; B5T overexpressed gene protein; RBBP-10; RBBP-9; retinoblastoma-binding protein 10; retinoblastoma-binding protein 9; retinoma-binding protein 9; RB binding protein 9, serine hydrolase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttctcctagcaaggcagtgattgttcccgggaacggaggcggggatgtgaccacccacggctggtatggctgggtgaaaaaggagctggagaagatacctggtttccagtgtttggctaaaaacatgcccgacccaattacagcacgagagagcatctggctgcccttcatggagacagagctgcactgtgatgagaagactatcatcattggccacagttctggggccatcgcggccatgaggtatgcagaaacacatcgagtatatgctattgtattagtgtctgcgtacacatcagacttgggggatgaaaatgagcgtgcaagtggatacttcacccgcccctggcagtgggagaagatcaaggccaactgcccttacattgtgcagtttggctctactgacgacccgttccttccctggaaggaacaacaagaagtggccgataggttggaaaccaaattgcacaaattcactgactgtggccactttcagaacacagagtttcatgaactgattactgttgtaaagtctttgctgaaagtaccagcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein MGC16385 - interleukin 6 (interferon, beta 2) - gypsy retrotransposon integrase 1 - hypothetical protein FLJ22662 |