Login to display prices
Login to display prices
RBBP9-retinoblastoma binding protein 9 Gene View larger

RBBP9-retinoblastoma binding protein 9 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBBP9-retinoblastoma binding protein 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBBP9-retinoblastoma binding protein 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015938
Product type: DNA & cDNA
Ncbi symbol: RBBP9
Origin species: Human
Product name: RBBP9-retinoblastoma binding protein 9 Gene
Size: 2ug
Accessions: BC015938
Gene id: 10741
Gene description: retinoblastoma binding protein 9
Synonyms: BOG; RBBP10; B5T overexpressed gene protein; RBBP-10; RBBP-9; retinoblastoma-binding protein 10; retinoblastoma-binding protein 9; retinoma-binding protein 9; RB binding protein 9, serine hydrolase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttctcctagcaaggcagtgattgttcccgggaacggaggcggggatgtgaccacccacggctggtatggctgggtgaaaaaggagctggagaagatacctggtttccagtgtttggctaaaaacatgcccgacccaattacagcacgagagagcatctggctgcccttcatggagacagagctgcactgtgatgagaagactatcatcattggccacagttctggggccatcgcggccatgaggtatgcagaaacacatcgagtatatgctattgtattagtgtctgcgtacacatcagacttgggggatgaaaatgagcgtgcaagtggatacttcacccgcccctggcagtgggagaagatcaaggccaactgcccttacattgtgcagtttggctctactgacgacccgttccttccctggaaggaacaacaagaagtggccgataggttggaaaccaaattgcacaaattcactgactgtggccactttcagaacacagagtttcatgaactgattactgttgtaaagtctttgctgaaagtaccagcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC16385
- interleukin 6 (interferon, beta 2)
- gypsy retrotransposon integrase 1
- hypothetical protein FLJ22662