Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene
PTXBC000744
New product
Data sheet of UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000744 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2I |
| Origin species: | Human |
| Product name: | UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000744 |
| Gene id: | 7329 |
| Gene description: | ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) |
| Synonyms: | C358B7.1; P18; UBC9; SUMO-conjugating enzyme UBC9; SUMO-1-protein ligase; SUMO-protein ligase; ubiquitin carrier protein 9; ubiquitin carrier protein I; ubiquitin conjugating enzyme 9; ubiquitin conjugating enzyme E2I; ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast); ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9); ubiquitin-conjugating enzyme UbcE2A; ubiquitin-like protein SUMO-1 conjugating enzyme; ubiquitin-protein ligase E2I; ubiquitin-protein ligase I; ubiquitin conjugating enzyme E2 I |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaaactacggatgcttttcaaagatgattatccatcttcgccaccaaaatgtaaattcgaaccaccattatttcacccgaatgtgtacccttcggggacagtgtgcctgtccatcttagaggaggacaaggactggaggccagccatcacaatcaaacagatcctattaggaatacaggaacttctaaatgaaccaaatatccaagacccagctcaagcagaggcctacacgatttactggttagtagcagccctggccccgctggtggcagctcctccccgtcccagccaaggccgcctggcaggacgggagtggagcacacaggctcaccctagggacagccagggtccgcgcctctgtggggaaggtcggggggcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Parkinson disease (autosomal recessive, early onset) 7 - killer cell lectin-like receptor subfamily G, member 1 - proteasome (prosome, macropain) subunit, alpha type, 8 - THAP domain containing, apoptosis associated protein 1 |