Login to display prices
Login to display prices
UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene View larger

UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000744
Product type: DNA & cDNA
Ncbi symbol: UBE2I
Origin species: Human
Product name: UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene
Size: 2ug
Accessions: BC000744
Gene id: 7329
Gene description: ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)
Synonyms: C358B7.1; P18; UBC9; SUMO-conjugating enzyme UBC9; SUMO-1-protein ligase; SUMO-protein ligase; ubiquitin carrier protein 9; ubiquitin carrier protein I; ubiquitin conjugating enzyme 9; ubiquitin conjugating enzyme E2I; ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast); ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9); ubiquitin-conjugating enzyme UbcE2A; ubiquitin-like protein SUMO-1 conjugating enzyme; ubiquitin-protein ligase E2I; ubiquitin-protein ligase I; ubiquitin conjugating enzyme E2 I
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaaactacggatgcttttcaaagatgattatccatcttcgccaccaaaatgtaaattcgaaccaccattatttcacccgaatgtgtacccttcggggacagtgtgcctgtccatcttagaggaggacaaggactggaggccagccatcacaatcaaacagatcctattaggaatacaggaacttctaaatgaaccaaatatccaagacccagctcaagcagaggcctacacgatttactggttagtagcagccctggccccgctggtggcagctcctccccgtcccagccaaggccgcctggcaggacgggagtggagcacacaggctcaccctagggacagccagggtccgcgcctctgtggggaaggtcggggggcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Parkinson disease (autosomal recessive, early onset) 7
- killer cell lectin-like receptor subfamily G, member 1
- proteasome (prosome, macropain) subunit, alpha type, 8
- THAP domain containing, apoptosis associated protein 1