KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene View larger

KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene

PTXBC012621

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012621
Product type: DNA & cDNA
Ncbi symbol: KLRG1
Origin species: Human
Product name: KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene
Size: 2ug
Accessions: BC012621
Gene id: 10219
Gene description: killer cell lectin-like receptor subfamily G, member 1
Synonyms: 2F1; CLEC15A; MAFA; MAFA-2F1; MAFA-L; MAFA-LIKE; killer cell lectin-like receptor subfamily G member 1; C-type lectin domain family 15 member A; ITIM-containing receptor MAFA-L; MAFA-like receptor; killer cell lectin-like receptor subfamily G, member 1; mast cell function-associated antigen (ITIM-containing); killer cell lectin like receptor G1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgacagtgttatttattccatgttagagttgcctacggcaacccaagcccagaatgactatggaccacagcaaaaatcttcctcttccaggccttcttgttcttgccttgtggcaatagctttggggcttctgactgcagttcttctgagtgtgctgctataccagtggatcctgtgccagggctccaactactccacttgtgccagctgtcctagctgcccagaccgctggatgaaatatggtaaccattgttattatttctcagtggaggaaaaggactggaattctagtctggaattctgcctagccagagactcacacctccttgtgataacggacaatcaggaaatgagcctgctccaagttttcctcagtgaggccttttgctggattggtctgaggaacaattctggctggaggtgggaagatggatcacctctaaacttctcaaggatttcttctaatagctttgtgcagacatgcggtgccatcaacaaaaatggtcttcaagcctcaagctgtgaagttcctttacactgggtgtgtaagaagtgtccctttgcagatcaagctttattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, alpha type, 8
- THAP domain containing, apoptosis associated protein 1
- ADP-ribosylation-like factor 6 interacting protein 4
- ADP-ribosylation-like factor 6 interacting protein 6

Buy KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene now

Add to cart