Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene
PTXBC012621
New product
Data sheet of KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLRG1 |
| Origin species: | Human |
| Product name: | KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC012621 |
| Gene id: | 10219 |
| Gene description: | killer cell lectin-like receptor subfamily G, member 1 |
| Synonyms: | 2F1; CLEC15A; MAFA; MAFA-2F1; MAFA-L; MAFA-LIKE; killer cell lectin-like receptor subfamily G member 1; C-type lectin domain family 15 member A; ITIM-containing receptor MAFA-L; MAFA-like receptor; killer cell lectin-like receptor subfamily G, member 1; mast cell function-associated antigen (ITIM-containing); killer cell lectin like receptor G1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgacagtgttatttattccatgttagagttgcctacggcaacccaagcccagaatgactatggaccacagcaaaaatcttcctcttccaggccttcttgttcttgccttgtggcaatagctttggggcttctgactgcagttcttctgagtgtgctgctataccagtggatcctgtgccagggctccaactactccacttgtgccagctgtcctagctgcccagaccgctggatgaaatatggtaaccattgttattatttctcagtggaggaaaaggactggaattctagtctggaattctgcctagccagagactcacacctccttgtgataacggacaatcaggaaatgagcctgctccaagttttcctcagtgaggccttttgctggattggtctgaggaacaattctggctggaggtgggaagatggatcacctctaaacttctcaaggatttcttctaatagctttgtgcagacatgcggtgccatcaacaaaaatggtcttcaagcctcaagctgtgaagttcctttacactgggtgtgtaagaagtgtccctttgcagatcaagctttattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, alpha type, 8 - THAP domain containing, apoptosis associated protein 1 - ADP-ribosylation-like factor 6 interacting protein 4 - ADP-ribosylation-like factor 6 interacting protein 6 |