Login to display prices
Login to display prices
PSMA8-proteasome (prosome, macropain) subunit, alpha type, 8 Gene View larger

PSMA8-proteasome (prosome, macropain) subunit, alpha type, 8 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMA8-proteasome (prosome, macropain) subunit, alpha type, 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMA8-proteasome (prosome, macropain) subunit, alpha type, 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025393
Product type: DNA & cDNA
Ncbi symbol: PSMA8
Origin species: Human
Product name: PSMA8-proteasome (prosome, macropain) subunit, alpha type, 8 Gene
Size: 2ug
Accessions: BC025393
Gene id: 143471
Gene description: proteasome (prosome, macropain) subunit, alpha type, 8
Synonyms: PSMA7L; proteasome subunit alpha type-7-like; proteasome (prosome, macropain) subunit, alpha type, 8; proteasome subunit alpha type 7-like protein variant 1; proteasome subunit alpha 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtctcgatatgacagggcgatcactgtcttctccccagacggacacctttttcaagttgaatatgcccaggaagcggtgaagaaaggatccaccgcggtcggaattcgaggacttactgctgatgctagagtagtaataaacagagcccgtgtggagtgccagagccataagcttacggttgaggacccagtcactgtagaatacataactcgcttcatagcaactttaaagcagaaatatacccaaagcaatggacgaagaccttttggtatttctgccttaattgtaggttttgatgatgatggtatctcaagattgtatcagacagatccttctggtacttatcatgcttggaaggcaaatgcaataggccgaagtgctaaaactgttcgagaatttctagaaaagaattacacagaagatgccatagcaagtgacagtgaagctatcaagttagcaataaaagctttgctagaagttgtccagtctggtggaagaaacattgaacttgctataataagaagaaatcaacctttgaagatgtttagtgcaaaagaagttgaattatatgtaactgaaatagaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - THAP domain containing, apoptosis associated protein 1
- ADP-ribosylation-like factor 6 interacting protein 4
- ADP-ribosylation-like factor 6 interacting protein 6
- proteasome (prosome, macropain) subunit, alpha type, 8