ARL6IP6-ADP-ribosylation-like factor 6 interacting protein 6 Gene View larger

ARL6IP6-ADP-ribosylation-like factor 6 interacting protein 6 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL6IP6-ADP-ribosylation-like factor 6 interacting protein 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARL6IP6-ADP-ribosylation-like factor 6 interacting protein 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028741
Product type: DNA & cDNA
Ncbi symbol: ARL6IP6
Origin species: Human
Product name: ARL6IP6-ADP-ribosylation-like factor 6 interacting protein 6 Gene
Size: 2ug
Accessions: BC028741
Gene id: 151188
Gene description: ADP-ribosylation-like factor 6 interacting protein 6
Synonyms: AIP-6; AIP6; PFAAP1; ADP-ribosylation factor-like protein 6-interacting protein 6; ADP-ribosylation factor GTPase 6 interacting protein 6; ADP-ribosylation factor-like 6 interacting protein 6; ADP-ribosylation-like factor 6 interacting protein 6; ARL-6-interacting protein 6; phosphonoformate immuno-associated protein 1; regulated by phosphonoformate; ADP ribosylation factor like GTPase 6 interacting protein 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtttgctgagagcgggtggcggtcggctctgcggcgccgcggtcccggcaccccgggccctgtggctcggccatcgtattcctcctttactcagggggacagctggggtgaaggcgaagtcgacgaggaggagggatgcgaccaagtggcccgcgacctgcgggcggagttctcggctggggcgtggtcagagcccagaaagcgctcggtgctcccgccggacgggaacgggtcgcccgttctgcccgataagcgcaatggtatctttcccgcggccgcgggcagcagagcccagcctcggcggtggccggtccaggtcctctctattctctgctcgctgctcttcgccattcttctcgccttcctcctcgccatcgcctacttgatcgttaaagagttgcatgctgagaatttgaaaaatgaagatgatgtagacactggactattaggattctggactctacttataatatccctaactgctggattctcctgttgcagcttttcttggacagtgacttactttgattcttttgaaccaggaatgtttcctcctactcctctttcacctgccaggttcaagaaactgactggacattctttccacatgggctatagcatggcgattttgaatggcatcgtagctgctcttactgtagcatggtgcctcatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, alpha type, 8
- proteasome (prosome, macropain) subunit, alpha type, 6
- methylmalonic aciduria (cobalamin deficiency) cblB type
- major histocompatibility complex, class II, DR alpha

Buy ARL6IP6-ADP-ribosylation-like factor 6 interacting protein 6 Gene now

Add to cart