Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene
PTXBC002979
New product
Data sheet of PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002979 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMA6 |
| Origin species: | Human |
| Product name: | PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene |
| Size: | 2ug |
| Accessions: | BC002979 |
| Gene id: | 5687 |
| Gene description: | proteasome (prosome, macropain) subunit, alpha type, 6 |
| Synonyms: | IOTA; PROS27; p27K; proteasome subunit alpha type-6; 27 kDa prosomal protein; PROS-27; macropain iota chain; macropain subunit iota; multicatalytic endopeptidase complex iota chain; prosomal P27K protein; proteasome (prosome, macropain) subunit, alpha type, 6; proteasome iota chain; proteasome subunit iota; testicular secretory protein Li 44; proteasome subunit alpha 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaaattattggattccagcacagtgactcacttattcaagataactgaaaacattggttgtgtgatgaccggaatgacagctgacagcagatcccaggtacagagggcacgctatgaggcagctaactggaaatacaagtatggctatgagattcctgtggacatgctgtgtaaaagaattgccgatatttctcaggtctacacacagaatgctgaaatgaggcctcttggttgttgtatgattttaattggtatagatgaagagcaaggccctcaggtatataagtgtgatcctgcaggttactactgtgggtttaaagccactgcagcgggagttaaacaaactgagtcaaccagcttccttgaaaaaaaagtgaagaagaaatttgattggacatttgaacagacagtggaaactgcaattacatgcctgtctactgttctatcaattgatttcaaaccttcagaaatagaagttggagtagtgacagttgaaaatcctaaattcaggattcttacagaagcagagattgatgctcaccttgttgctctagcagagagagactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - methylmalonic aciduria (cobalamin deficiency) cblB type - major histocompatibility complex, class II, DR alpha - tumor necrosis factor receptor superfamily, member 9 - potassium voltage-gated channel, subfamily G, member 4 |