Login to display prices
Login to display prices
PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene View larger

PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene

PTXBC002979

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene

Proteogenix catalog: PTXBC002979
Ncbi symbol: PSMA6
Product name: PSMA6-proteasome (prosome, macropain) subunit, alpha type, 6 Gene
Size: 2ug
Accessions: BC002979
Gene id: 5687
Gene description: proteasome (prosome, macropain) subunit, alpha type, 6
Synonyms: IOTA; PROS27; p27K; proteasome subunit alpha type-6; 27 kDa prosomal protein; PROS-27; macropain iota chain; macropain subunit iota; multicatalytic endopeptidase complex iota chain; prosomal P27K protein; proteasome (prosome, macropain) subunit, alpha type, 6; proteasome iota chain; proteasome subunit iota; testicular secretory protein Li 44; proteasome subunit alpha 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaaattattggattccagcacagtgactcacttattcaagataactgaaaacattggttgtgtgatgaccggaatgacagctgacagcagatcccaggtacagagggcacgctatgaggcagctaactggaaatacaagtatggctatgagattcctgtggacatgctgtgtaaaagaattgccgatatttctcaggtctacacacagaatgctgaaatgaggcctcttggttgttgtatgattttaattggtatagatgaagagcaaggccctcaggtatataagtgtgatcctgcaggttactactgtgggtttaaagccactgcagcgggagttaaacaaactgagtcaaccagcttccttgaaaaaaaagtgaagaagaaatttgattggacatttgaacagacagtggaaactgcaattacatgcctgtctactgttctatcaattgatttcaaaccttcagaaatagaagttggagtagtgacagttgaaaatcctaaattcaggattcttacagaagcagagattgatgctcaccttgttgctctagcagagagagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: