Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
PTXBC008969
New product
Data sheet of KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008969 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNG4 |
| Origin species: | Human |
| Product name: | KCNG4-potassium voltage-gated channel, subfamily G, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC008969 |
| Gene id: | 93107 |
| Gene description: | potassium voltage-gated channel, subfamily G, member 4 |
| Synonyms: | KV6.3; KV6.4; potassium voltage-gated channel subfamily G member 4; potassium channel, voltage gated modifier subfamily G, member 4; potassium voltage-gated channel, subfamily G, member 4; voltage-gated potassium channel Kv6.3; voltage-gated potassium channel subunit Kv6.4; potassium voltage-gated channel modifier subfamily G member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccatgccttccagagacgggggcctgcatcccagacaccaccactatggttcccacagcccttggagtcagctcctgtccagccccatggagacgccgtccatcaagggcctttactaccggagggtgcggaaggtgggtgccctggacgcctccccagtggacctgaagaaggagatcctgatcaacgtggggggcaggaggtatctcctcccctggagcacactggaccggttcccgctgagccgcctgagcaaactcaggctctgtcggagctacgaggagatcgtgcagctctgcgatgattacgacgaggacagccaggagttcttcttcgacaggagccccagcgccttcggggtgatcgtgagcttcctggcggccgggaagctggtgcttctgcaggagatgtgcgcgctgtccttccaggaggagctggcctactggggcatcgaggaggcccacctggagaggtgctgcctgcggaagctgctgaggaagctggaggagctggaggagctggccaagctgcacagggaggacgtactgaggcagcagagggagacccgccgccccgcctcgcactcctcgcgctggggcctgtgcatgaaccggctgcgcgagatggtggaaaacccgcagtccgggctgcccgggaaggtcttcgcttgcctctccatcctcttcgtggccaccacagccgtcagcctgtgtgtcagcaccatgcccgacctcagggcagaggaggaccaggtgagcggcctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) - proteasome (prosome, macropain) subunit, alpha type, 1 - vacuolar protein sorting 37 homolog B (S. cerevisiae) - cyclin-dependent kinase 5, regulatory subunit 1 (p35) |