Login to display prices
Login to display prices
SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene View larger

SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008976
Product type: DNA & cDNA
Ncbi symbol: SNF8
Origin species: Human
Product name: SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC008976
Gene id: 11267
Gene description: SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
Synonyms: SNF8, ESCRT-II complex subunit; SNF8, ESCRT-II complex subunit, homolog; vacuolar-sorting protein SNF8; Dot3; EAP30; VPS22; EAP30 subunit of ELL complex; ELL-associated protein of 30 kDa; ESCRT-II complex subunit VPS22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccgccgcggggtgggagctggcgccatcgccaagaagaaacttgcagaggccaagtataaggagcgagggacggtcttggctgaggaccagctagcccagatgtcaaagcagttggacatgttcaagaccaacctggaggaatttgccagcaaacacaagcaggagatccggaagaatcctgagttccgtgtgcagttccaggacatgtgtgcaaccattggcgtggatccgctggcctctggaaaaggattttggtctgagatgctgggcgtgggggacttctattacgaactaggtgtccaaattatcgaagtgtgcctggcgctgaagcatcggaatggaggtctgataactttggaggaactacatcaacaggtgttgaagggaaggggcaagttcgcccaggatgtcagtcaagatgacctgatcagagccatcaagaaactaaaggcacttggcactggcttcggcatcatccctgtgggcggcacttacctcattcagtctgttccagctgagctcaatatggatcacaccgtggtgctgcagctggcagagaagaatggctacgtgactgtcagtgagatcaaagccagtcttaaatgggagaccgagcgagcgcggcaagtgctggaacacctgctgaaggaagggttggcgtggctggacttacaggccccaggggaggcccactactggctgccagctctcttcactgacctctactcccaggagattacagctgaggaggccagagaagccctcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, alpha type, 1
- vacuolar protein sorting 37 homolog B (S. cerevisiae)
- cyclin-dependent kinase 5, regulatory subunit 1 (p35)
- cyclin-dependent kinase 5, regulatory subunit 1 (p35)