Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene
PTXBC002577
New product
Data sheet of PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002577 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMA1 |
| Origin species: | Human |
| Product name: | PSMA1-proteasome (prosome, macropain) subunit, alpha type, 1 Gene |
| Size: | 2ug |
| Accessions: | BC002577 |
| Gene id: | 5682 |
| Gene description: | proteasome (prosome, macropain) subunit, alpha type, 1 |
| Synonyms: | HC2; HEL-S-275; PROS30; proteasome subunit alpha type-1; 30 kDa prosomal protein; PROS-30; epididymis secretory protein Li 275; macropain subunit C2; macropain subunit nu; multicatalytic endopeptidase complex subunit C2; proteasome (prosome, macropain) subunit, alpha type, 1; proteasome component C2; proteasome nu chain; proteasome subunit nu; proteasome subunit, alpha-type, 1; protein P30-33K; testicular tissue protein Li 150; proteasome subunit alpha 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttcgaaatcagtatgacaatgatgtcactgtttggagcccccagggcaggattcatcaaattgaatatgcaatggaagctgttaaacaaggttcagccacagttggtctgaaatcaaaaactcatgcagttttggttgcattgaaaagggcgcaatcagagcttgcagctcatcagaaaaaaattctccatgttgacaaccatattggtatctcaattgcggggcttactgctgatgctagactgttatgtaattttatgcgtcaggagtgtttggattccagatttgtattcgatagaccactgcctgtgtctcgtcttgtatctctaattggaagcaagacccagataccaacacaacgatatggccggagaccatatggtgttggtctccttattgctggttatgatgatatgggccctcacattttccaaacctgtccatctgctaactattttgactgcagagccatgtccattggagcccgttcccaatcagctcgtacttacttggagagacatatgtctgaatttatggagtgtaatttaaatgaactagttaaacatggtctgcgtgccttaagagagacgcttcctgcagaacaggacctgactacaaagaatgtttccattggaattgttggtaaagacttggagtttacaatctatgatgatgatgatgtgtctccattcctggaaggtcttgaagaaagaccacagagaaaggcacagcctgctcaacctgctgatgaacctgcagaaaaggctgatgaaccaatggaacattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 37 homolog B (S. cerevisiae) - cyclin-dependent kinase 5, regulatory subunit 1 (p35) - cyclin-dependent kinase 5, regulatory subunit 1 (p35) - Fc fragment of IgG, low affinity IIb, receptor (CD32) |