FCGR2B-Fc fragment of IgG, low affinity IIb, receptor (CD32) Gene View larger

FCGR2B-Fc fragment of IgG, low affinity IIb, receptor (CD32) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FCGR2B-Fc fragment of IgG, low affinity IIb, receptor (CD32) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FCGR2B-Fc fragment of IgG, low affinity IIb, receptor (CD32) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031992
Product type: DNA & cDNA
Ncbi symbol: FCGR2B
Origin species: Human
Product name: FCGR2B-Fc fragment of IgG, low affinity IIb, receptor (CD32) Gene
Size: 2ug
Accessions: BC031992
Gene id: 2213
Gene description: Fc fragment of IgG, low affinity IIb, receptor (CD32)
Synonyms: CD32; CD32B; FCG2; FCGR2; IGFR2; low affinity immunoglobulin gamma Fc region receptor II-b; CDw32; Fc fragment of IgG, low affinity II, receptor for (CD32); Fc fragment of IgG, low affinity IIb, receptor (CD32); Fc fragment of IgG, low affinity IIb, receptor for (CD32); Fc gamma RIIb; Fc gamma receptor IIb; fc-gamma RII-b; fc-gamma-RIIb; fcRII-b; igG Fc receptor II-b; Fc fragment of IgG receptor IIb
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaatcctgtcattcttacctgtccttgccactgagagtgactgggctgactgcaagtccccccagccttggggtcatatgcttctgtggacagctgtgctattcctggctcctgttgctgggacacctgcagctcccccaaaggctgtgctgaaactcgagccccagtggatcaacgtgctccaggaggactctgtgactctgacatgccgggggactcacagccctgagagcgactccattcagtggttccacaatgggaatctcattcccacccacacgcagcccagctacaggttcaaggccaacaacaatgacagcggggagtacacgtgccagactggccagaccagcctcagcgaccctgtgcatctgactgtgctttctgagtggctggtgctccagacccctcacctggagttccaggagggagaaaccatcgtgctgaggtgccacagctggaaggacaagcctctggtcaaggtcacattcttccagaatggaaaatccaagaaattttcccgttcggatcccaacttctccatcccacaagcaaaccacagtcacagtggtgattaccactgcacaggaaacataggctacacgctgtactcatccaagcctgtgaccatcactgtccaagctcccagctcttcaccgatggggatcattgtggctgtggtcactgggattgctgtagcggccattgttgctgctgtagtggccttgatctactgcaggaaaaagcggatttcagctctcccaggataccctgagtgcagggaaatgggagagaccctccctgagaaaccagccaatcccactaatcctgatgaggctgacaaagttggggctgagaacacaatcacctattcacttctcatgcacccggatgctctggaagagcctgatgaccagaaccgtatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phytanoyl-CoA 2-hydroxylase interacting protein-like
- pyridoxal-dependent decarboxylase domain containing 1
- suppressor of variegation 3-9 homolog 2 (Drosophila)
- Fc fragment of IgG, high affinity Ia, receptor (CD64)

Buy FCGR2B-Fc fragment of IgG, low affinity IIb, receptor (CD32) Gene now

Add to cart