PHYHIPL-phytanoyl-CoA 2-hydroxylase interacting protein-like Gene View larger

PHYHIPL-phytanoyl-CoA 2-hydroxylase interacting protein-like Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHYHIPL-phytanoyl-CoA 2-hydroxylase interacting protein-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PHYHIPL-phytanoyl-CoA 2-hydroxylase interacting protein-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011268
Product type: DNA & cDNA
Ncbi symbol: PHYHIPL
Origin species: Human
Product name: PHYHIPL-phytanoyl-CoA 2-hydroxylase interacting protein-like Gene
Size: 2ug
Accessions: BC011268
Gene id: 84457
Gene description: phytanoyl-CoA 2-hydroxylase interacting protein-like
Synonyms: phytanoyl-CoA hydroxylase-interacting protein-like; phytanoyl-CoA 2-hydroxylase interacting protein like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaacttcctgtaccacataacatcaaaataagcaatataacgtgtgactcattcaagatttcatgggaaatggattcaaaatcaaaggatcgcattacacactattttattgacctcaacaagaaagagaacaagaactccaataaatttaaacacaaggatgttcccacaaaattggtggcaaaagctgttcccttgcctatgactgtccgtggacactggtttttaagcccaagaactgaatatacagtagcagtgcagactgcctcaaaacaagttgatggtgattatgttgtgtctgaatggagtgaaattatagaattctgcaccgcagactattcaaaagttcatctaacacaattgttggagaaggctgaagtgattgcaggacgcatgcttaagttttctgttttttatcgtaatcagcacaaagaatattttgactatgttcgagaacatcatgggaatgctatgcagccatctgtcaaggataacagtggtagccatggctctcctatcagtggaaaattagaaggcatcttcttcagctgcagcactgaattcaatactggaaagccaccccaggattcaccttatggaagatacaggtttgagattgccgcagaaaaactttttaaccccaatactaacttatactttggggacttctactgtatgtacactgcttatcattatgtgattcttgttattgctcctgtgggatcaccaggagatgaattttgtaagcagcgccttcctcaactaaattctaaggataataaatttttgacctgtacagaagaagatggggtgctggtttaccaccatgcccaggatgtcattttagaagtcatttacactgaccctgtggatctttctctgggcaccgtggcagaaatcactggtcatcagctcatgagtttgtctactgcaaatgcaaagaaagatcccagctgcaaaacctgtaatatcagtgttggacgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyridoxal-dependent decarboxylase domain containing 1
- suppressor of variegation 3-9 homolog 2 (Drosophila)
- Fc fragment of IgG, high affinity Ia, receptor (CD64)
- zinc binding alcohol dehydrogenase domain containing 2

Buy PHYHIPL-phytanoyl-CoA 2-hydroxylase interacting protein-like Gene now

Add to cart