Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ZADH2-zinc binding alcohol dehydrogenase domain containing 2 Gene
PTXBC033780
New product
Data sheet of ZADH2-zinc binding alcohol dehydrogenase domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZADH2-zinc binding alcohol dehydrogenase domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033780 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZADH2 |
| Origin species: | Human |
| Product name: | ZADH2-zinc binding alcohol dehydrogenase domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC033780 |
| Gene id: | 284273 |
| Gene description: | zinc binding alcohol dehydrogenase domain containing 2 |
| Synonyms: | PRG-3; prostaglandin reductase 3; zinc-binding alcohol dehydrogenase domain-containing protein 2; zinc binding alcohol dehydrogenase domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcggctggtgcccaccggggcccgggccatcgtggacatgtcgtacgcccgccacttcctggacttccagggctccgccattccccaagccatgcagaagctggtggtgacccggctgagccccaacttccgcgaggccgtcaccctgagccgggactgcccggtgccgctccccggggacggagacctcctcgtccggaaccgatttgttggtgttaacgcatctgacatcaactattcagcaggccgctatgacccctcagttaagcctccctttgacataggtttcgaaggcattggggaggtggtggccctaggcctctctgctagtgccagatacacagttggccaagctgtggcttacatggcacctggttcttttgctgagtacacagttgtgcctgccagcattgcaactccagtgccctcagtgaaacccgagtatcttaccctgctggtaagtggcaccaccgcatacatcagcctgaaagagctcggaggactgtcggaagggaaaaaagttttggtgacagcagcagctgggggaacgggccagtttgccatgcagctttcaaagaaggcaaagtgccatgtaattggaacctgctcttctgatgaaaagtctgcttttctgaaatctcttggctgtgatcgtcctatcaactataaaactgaacccgtaggtaccgtccttaagcaggagtaccctgaaggtgtcgatgtggtctatgaatctgttgggggagccatgtttgacttggctgtagacgccctggctacgaaagggcgcttgatagtaatagggtttatctctggctaccaaactcctactggcctttcgcctgtgaaagcaggaacattgccagccaaactgctcaagaaatctgccagcgtacagggcttcttcctgaaccattacctttctaagtatcaagcagccatgagccacttgctcgagatgtgtgtgagcggagacctggtttgtgaggtggaccttggagatctgtctccagagggcaggtttactggcctggagtccatattccgtgctgtcaattatatgtacatgggaaaaaacactggaaaaattgtagttgaattacctcactctgtcaacagtaagctgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) - Bernardinelli-Seip congenital lipodystrophy 2 (seipin) - proteasome (prosome, macropain) 26S subunit, ATPase, 5 - suppressor of variegation 3-9 homolog 1 (Drosophila) |