BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene View larger

BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004911
Product type: DNA & cDNA
Ncbi symbol: BSCL2
Origin species: Human
Product name: BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene
Size: 2ug
Accessions: BC004911
Gene id: 26580
Gene description: Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonyms: BSCL2, seipin lipid droplet biogenesis associated; GNG3LG; HMN5; PELD; SPG17; seipin; Berardinelli-Seip congenital lipodystrophy 2 (seipin); Bernardinelli-Seip congenital lipodystrophy type 2 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcaacgaccctccagtacctgccttactgtgggcccaggaggtgggccaagtcttggcaggccgtgcccgcaggctgctgctgcagtttggggtgctcttctgcaccatcctccttttgctctgggtgtctgtcttcctctatggctccttctactattcctatatgccgacagtcagccacctcagccctgtgcatttctactacaggaccgactgtgattcctccaccacctcactctgctccttccctgttgccaatgtctcgctgactaagggtggacgtgatcgggtgctgatgtatggacagccgtatcgtgttaccttagagcttgagctgccagagtcccctgtgaatcaagatttgggcatgttcttggtcaccatttcctgctacaccagaggtggccgaatcatctccacttcttcgcgttcggtgatgctgcattaccgctcagacctgctccagatgctggacacactggtcttctctagcctcctgctatttggctttgcagagcagaagcagctgctggaggtggaactctacgcagactatagagagaactcgtacgtgccgaccactggagcgatcattgagatccacagcaagcgcatccagctgtatggagcctacctccgcatccacgcgcacttcactgggctcagatacctgctatacaacttcccgatgacctgcgccttcataggtgttgccagcaacttcaccttcctcagcgtcatcgtgctcttcagctacatgcagtgggtgtgggggggcatctggccccgacaccgcttctctttgcaggttaacatccgaaaaagagacaattcccggaaggaagtccaacgaaggatctctgctcatcagccagggcctgaaggccaggaggagtcaactccgcaatcagatgttacagaggatggtgagagccctgaggatccctcagggacagagggtcagctgtccgaggaggagaaaccagatcagcagcccctgagcggagaagaggagctagagcctgaggccagtgatggttcaggctcctgggaagatgcagctttgctgacggaggccaacctgcctgctcctgctcctgcttctgcttctgcccctgtcctagagactctgggcagctctgaacctgctgggggtgctctccgacagcgccccacctgctctagttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, ATPase, 5
- suppressor of variegation 3-9 homolog 1 (Drosophila)
- fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
- cytochrome P450, family 3, subfamily A, polypeptide 5

Buy BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene now

Add to cart