Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene
PTXBC001932
New product
Data sheet of PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001932 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMC5 |
| Origin species: | Human |
| Product name: | PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene |
| Size: | 2ug |
| Accessions: | BC001932 |
| Gene id: | 5705 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, ATPase, 5 |
| Synonyms: | SUG-1; SUG1; TBP10; TRIP1; p45; p45/SUG; 26S protease regulatory subunit 8; 26S proteasome AAA-ATPase subunit RPT6; MSUG1 protein; Tat-binding protein homolog 10; proteasome (prosome, macropain) 26S subunit, ATPase, 5; proteasome 26S ATPase subunit 5; proteasome subunit p45; testicular tissue protein Li 149; thyroid hormone receptor-interacting protein 1; thyroid receptor interactor 1; proteasome 26S subunit, ATPase 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcttgacggaccagagcagatggagctggaggaggggaaggcaggcagcggactccgccaatattatctgtccaagattgaagaactccagctgattgtgaatgataagagccaaaacctccggaggctgcaggcacagaggaacgaactaaatgctaaagttcgcctattgcgggaggagctacagctgctgcaggagcagggctcctatgtgggggaagtagtccgggccatggataagaagaaagtgttggtcaaggtacatcctgaaggtaaatttgttgtagacgtggacaaaaacattgacatcaatgatgtgacacccaattgccgggtggctctaaggaatgacagctacactctgcacaagatcctgcccaacaaggtagacccattagtgtcactgatgatggtggagaaagtaccagattcaacttatgagatgattggtggactggacaaacagatcaaggagatcaaagaagtgatcgagctgcctgttaagcatcctgagctcttcgaagcactgggcattgctcagcccaagggagtgctgctgtatggacctccaggcactgggaagacactgttggcccgggctgtggctcatcatacggactgtacctttattcgtgtctctggctctgaactggtacagaaattcataggggaaggggcaagaatggtgagggagctgtttgtcatggcacgggaacatgctccatctatcatcttcatggacgaaatcgactccatcggctcctcgcggctggaggggggttctggaggggacagtgaagtgcagcgcacgatgctggagttgctcaaccagctcgacggctttgaggccaccaagaacatcaaggttatcatggctactaataggattgatatcctggactcggcactgcttcgcccagggcgcattgacagaaaaattgaattcccaccccccaatgaggaggcccggctggacattttgaagattcattctcggaagatgaacctgacccgggggatcaacctgagaaaaattgctgagctcatgccaggagcatcaggggctgaagtgaagggcgtgtgcacagaagctggcatgtatgccctgcgagaacggcgagtccatgtcactcaggaggactttgagatggcagtagccaaggtcatgcagaaggacagtgagaaaaacatgtccatcaagaaattatggaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - suppressor of variegation 3-9 homolog 1 (Drosophila) - fucosyltransferase 11 (alpha (1,3) fucosyltransferase) - cytochrome P450, family 3, subfamily A, polypeptide 5 - cytochrome P450, family 2, subfamily S, polypeptide 1 |