PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene View larger

PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001932
Product type: DNA & cDNA
Ncbi symbol: PSMC5
Origin species: Human
Product name: PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene
Size: 2ug
Accessions: BC001932
Gene id: 5705
Gene description: proteasome (prosome, macropain) 26S subunit, ATPase, 5
Synonyms: SUG-1; SUG1; TBP10; TRIP1; p45; p45/SUG; 26S protease regulatory subunit 8; 26S proteasome AAA-ATPase subunit RPT6; MSUG1 protein; Tat-binding protein homolog 10; proteasome (prosome, macropain) 26S subunit, ATPase, 5; proteasome 26S ATPase subunit 5; proteasome subunit p45; testicular tissue protein Li 149; thyroid hormone receptor-interacting protein 1; thyroid receptor interactor 1; proteasome 26S subunit, ATPase 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcttgacggaccagagcagatggagctggaggaggggaaggcaggcagcggactccgccaatattatctgtccaagattgaagaactccagctgattgtgaatgataagagccaaaacctccggaggctgcaggcacagaggaacgaactaaatgctaaagttcgcctattgcgggaggagctacagctgctgcaggagcagggctcctatgtgggggaagtagtccgggccatggataagaagaaagtgttggtcaaggtacatcctgaaggtaaatttgttgtagacgtggacaaaaacattgacatcaatgatgtgacacccaattgccgggtggctctaaggaatgacagctacactctgcacaagatcctgcccaacaaggtagacccattagtgtcactgatgatggtggagaaagtaccagattcaacttatgagatgattggtggactggacaaacagatcaaggagatcaaagaagtgatcgagctgcctgttaagcatcctgagctcttcgaagcactgggcattgctcagcccaagggagtgctgctgtatggacctccaggcactgggaagacactgttggcccgggctgtggctcatcatacggactgtacctttattcgtgtctctggctctgaactggtacagaaattcataggggaaggggcaagaatggtgagggagctgtttgtcatggcacgggaacatgctccatctatcatcttcatggacgaaatcgactccatcggctcctcgcggctggaggggggttctggaggggacagtgaagtgcagcgcacgatgctggagttgctcaaccagctcgacggctttgaggccaccaagaacatcaaggttatcatggctactaataggattgatatcctggactcggcactgcttcgcccagggcgcattgacagaaaaattgaattcccaccccccaatgaggaggcccggctggacattttgaagattcattctcggaagatgaacctgacccgggggatcaacctgagaaaaattgctgagctcatgccaggagcatcaggggctgaagtgaagggcgtgtgcacagaagctggcatgtatgccctgcgagaacggcgagtccatgtcactcaggaggactttgagatggcagtagccaaggtcatgcagaaggacagtgagaaaaacatgtccatcaagaaattatggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - suppressor of variegation 3-9 homolog 1 (Drosophila)
- fucosyltransferase 11 (alpha (1,3) fucosyltransferase)
- cytochrome P450, family 3, subfamily A, polypeptide 5
- cytochrome P450, family 2, subfamily S, polypeptide 1

Buy PSMC5-proteasome (prosome, macropain) 26S subunit, ATPase, 5 Gene now

Add to cart