DDI1-DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) Gene View larger

DDI1-DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDI1-DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDI1-DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022017
Product type: DNA & cDNA
Ncbi symbol: DDI1
Origin species: Human
Product name: DDI1-DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC022017
Gene id: 414301
Gene description: DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)
Synonyms: DDI1, DNA-damage inducible 1, homolog 1; protein DDI1 homolog 1; DNA-damage inducible protein 1; DNA damage inducible 1 homolog 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgatcaccgtgtactgcgtgcggagggacctctccgaggtcaccttctctctccaggtcagccccgactttgagctccgaaacttcaaggtcctctgcgaagcggagtccagagtccccgtcgaagagatccagatcatccacatggagcgactcctcatcgaggaccactgttccctgggctcctacggcctcaaagatggcgatatcgtggttttactgcagaaggacaatgtgggacctcgggctccagggcgtgccccgaaccagcctcgtgtagacttcagtggcattgcggtgcctgggacgtccagctcccgtccacagcaccctggacagcagcagcagcgcacacccgctgcccagcggtcacagggcttggcgtcaggagagaaggtggccggcctgcaaggtctgggcagccccgccctgatccgcagcatgctgctctccaacccccacgatctgtccctgctcaaggaacgcaaccctcccttggcggaagccctgctcagcggaagccttgagaccttttctcaggtgctgatggagcagcaaagggaaaaggccttgagagagcaagagaggcttcgtctctacacagccgacccactggatcgggaagctcaggccaaaatagaagaggaaatccggcagcaaaacattgaagaaaacatgaatatagcgatagaagaggcccccgagagttttggacaagtgacgatgctctacattaactgcaaagtgaatgggcatcctttgaaggcttttgttgactcgggcgcccagatgaccattatgagccaggcttgtgccgagcgatgtaacatcatgaggctggtggaccgacggtgggctggggttgctaaaggagtgggcacacagagaattattggccgtgttcatctagctcagattcaaattgaaggtgatttcttacagtgctctttctccatacttgaggatcaacccatggatatgcttctaggcctagatatgctccggagacatcaatgttccatcgatttgaagaaaaatgtgctggtcatcggcaccactggcacgcagacttattttcttcctgagggagagttgcccttatgctctaggatggtaagtgggcaagatgagtcttcggacaaggaaattacacattcagtcatggattcaggacgaaaagaacattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
- proteasome (prosome, macropain) 26S subunit, ATPase, 5
- suppressor of variegation 3-9 homolog 1 (Drosophila)
- fucosyltransferase 11 (alpha (1,3) fucosyltransferase)

Buy DDI1-DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) Gene now

Add to cart