Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FCGR1A-Fc fragment of IgG, high affinity Ia, receptor (CD64) Gene
PTXBC032634
New product
Data sheet of FCGR1A-Fc fragment of IgG, high affinity Ia, receptor (CD64) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCGR1A-Fc fragment of IgG, high affinity Ia, receptor (CD64) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032634 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCGR1A |
| Origin species: | Human |
| Product name: | FCGR1A-Fc fragment of IgG, high affinity Ia, receptor (CD64) Gene |
| Size: | 2ug |
| Accessions: | BC032634 |
| Gene id: | 2209 |
| Gene description: | Fc fragment of IgG, high affinity Ia, receptor (CD64) |
| Synonyms: | CD64A; FCRI; IGFR1; high affinity immunoglobulin gamma Fc receptor I; Fc fragment of IgG, high affinity Ia, receptor (CD64); Fc fragment of IgG, high affinity Ia, receptor for (CD64); Fc gamma receptor; Fc gamma receptor Ia; Fc-gamma RI; Fc-gamma receptor I A1; IgG Fc receptor I; fc-gamma RIA; fcgammaRIa; Fc fragment of IgG receptor Ia |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggttcttgacaactctgctcctttgggttccagttgatgggcaagtggacaccacaaaggcagtgatcactttgcagcctccatgggtcagcgtgttccaagaggaaaccgtaaccttgcattgtgaggtgctccatctgcctgggagcagctctacacagtggtttctcaatggcacagccactcagacctcgacccccagctacagaatcacctctgccagtgtcaatgacagtggtgaatacaggtgccagagaggtctctcagggcgaagtgaccccatacagctggaaatccacagaggctggctactactgcaggtctccagcagagtcttcacggaaggagaacctctggccttgaggtgtcatgcgtggaaggataagctggtgtacaatgtgctttactatcgaaatggcaaagcctttaagtttttccactggaattctaacctcaccattctgaaaaccaacataagtcacaatggcacctaccattgctcaggcatgggaaagcatcgctacacatcagcaggaatatctgtcactgtgaaagagctatttccagctccagtgctgaatgcatctgtgacatccccactcctggaggggaatctggtcaccctgagctgtgaaacaaagttgctcttgcagaggcctggtttgcagctttacttctccttctacatgggcagcaagaccctgcgaggcaggaacacatcctctgaataccaaatactaactgctagaagagaagactctgggttatactggtgcgaggctgccacagaggatggaaatgtccttaagcgcagccctgagttggagcttcaagtgcttggcctccagttaccaactcctgtctggtttcatgtccttttctatctggcagtgggaataatgtttttagtgaacactgttctctgggtgacaatacgtaaagaactgaaaagaaagaaaaagtgggatttagaaatctctttggattctggtcatgagaagaaggtaatttccagccttcaagaagacagacatttagaagaagagctgaaatgtcaggaacaaaaagaagaacagctgcaggaaggggtgcaccggaaggagccccagggggccacgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc binding alcohol dehydrogenase domain containing 2 - DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) - Bernardinelli-Seip congenital lipodystrophy 2 (seipin) - proteasome (prosome, macropain) 26S subunit, ATPase, 5 |