CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene View larger

CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030792
Product type: DNA & cDNA
Ncbi symbol: CDK5R1
Origin species: Human
Product name: CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene
Size: 2ug
Accessions: BC030792
Gene id: 8851
Gene description: cyclin-dependent kinase 5, regulatory subunit 1 (p35)
Synonyms: CDK5P35; CDK5R; NCK5A; p23; p25; p35; p35nck5a; cyclin-dependent kinase 5 activator 1; CDK5 activator 1; TPKII regulatory subunit; neuronal CDK5 activator; regulatory partner for CDK5 kinase; tau protein kinase II 23kDa subunit; cyclin dependent kinase 5 regulatory subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcacggtgctgtccctgtctcccagctaccggaaggccacgctgtttgaggatggcgcggccaccgtgggccactatacggccgtacagaacagcaagaacgccaaggacaagaacctgaagcgccactccatcatctccgtgctgccttggaagagaatcgtggccgtgtcggccaagaagaagaactcaaagaaggtgcagcccaacagcagctaccagaacaacatcacgcacctcaacaatgagaacctgaagaagtcgctgtcgtgcgccaacctgtccacattcgcccagcccccaccggcccagccgcctgcacccccggccagccagctctcgggttcccagaccgggggctcctcctcagtcaagaaagcccctcaccctgccgtcacctccgcagggacgcccaaacgggtcatcgtccaggcgtccaccagtgagctgcttcgctgcctgggtgagtttctctgccgccggtgctaccgcctgaagcacctgtcccccacggaccccgtgctctggctgcgcagcgtggaccgctcgctgcttctgcagggctggcaggacaagggcttcatcacgccggccaacgtggtcttcctctacatgctctgcagggatgttatctcctccgaggtgggctcggatcacgagctccaggccgtcctgctgacatgcctgtacctctcctactcctacatgggcaacgagatctcctacccgctcaagcccttcctggtggagagctgcaaggaggccttttgggaccgttgcctctctgtcatcaacctcatgagctcaaagatgctgcagataaatgccgacccacactacttcacacaggtcttctccgacctgaagaacgagagcggccaggaggacaagaagcggctcctcctaggcctggatcggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Fc fragment of IgG, low affinity IIb, receptor (CD32)
- phytanoyl-CoA 2-hydroxylase interacting protein-like
- pyridoxal-dependent decarboxylase domain containing 1
- suppressor of variegation 3-9 homolog 2 (Drosophila)

Buy CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene now

Add to cart