Login to display prices
Login to display prices
VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene View larger

VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene

PTXBC005882

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene

Proteogenix catalog: PTXBC005882
Ncbi symbol: VPS37B
Product name: VPS37B-vacuolar protein sorting 37 homolog B (S. cerevisiae) Gene
Size: 2ug
Accessions: BC005882
Gene id: 79720
Gene description: vacuolar protein sorting 37 homolog B (S. cerevisiae)
Synonyms: VPS37B, ESCRT-I subunit; ESCRT-I complex subunit VPS37B; vacuolar protein sorting-associated protein 37B; hVps37B; vacuolar protein sorting 37 homolog B; vacuolar protein sorting 37B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggcgccgggagcgaagcccggttcgccgggctgtcgctggtgcagctcaacgagctgctggaggacgagggccagctgacggagatggtgcagaagatggaggagacacagaatgttcagcttaacaaagaaatgacacttgccagcaaccggagcctggcagaaggaaaccttttgtaccagccccagctggacacgttgaaagcacgcttgacccagaaataccaggaactccaggttctctttgaagcctatcagataaagaagaccaaattagacagacagtctagcagtgcttccttggagaccctgttagcacttcttcaggcagaaggggccaagattgaggaagacactgagaacatggcagagaagtttctggatggagaacttcctctggattccttcattgatgtctatcagagcaaacggaaactggcccacatgcgacgggtgaaaatcgagaagctccaggagatggtcctaaaggggcagagactcccacaggccctggccccgctgccccccaggctgcccgaactggcacctaccgccccccttccctaccctgccccagaggccagtgggcctcctgccgttgcacctcggcgcatcccccccccaccacccccggtgcctgcgggacgcttagccaccccgtttactgcggccatgagttcgggacaggccgtgccgtacccaggattacagtgcccgcccctgcccccccgcgtgggcctccccactcagcaaggattctcttcgcagttcgtgtccccatatccgccacctctccctcagagacccccgccccggctccctccacaccagccgggtttcatcctccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: