Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene
PTXBC011831
New product
Data sheet of MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011831 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MMAB |
| Origin species: | Human |
| Product name: | MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene |
| Size: | 2ug |
| Accessions: | BC011831 |
| Gene id: | 326625 |
| Gene description: | methylmalonic aciduria (cobalamin deficiency) cblB type |
| Synonyms: | ATR; CFAP23; cblB; cob; cob(I)yrinic acid a,c-diamide adenosyltransferase, mitochondrial; ATP:cob(I)alamin adenosyltransferase; ATP:corrinoid adenosyltransferase; aquocob(I)alamin vitamin B12s adenosyltransferase; cilia and flagella associated protein 23; methylmalonic aciduria type B protein; methylmalonic aciduria (cobalamin deficiency) cblB type |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgtgtgcggcctggggagccgtcttggcctggggagccgtcttggcctgcgcgggtgcttcggcgccgccaggctcctgtatccccgtttccagagccgcggccctcagggcgtggaagacggggacaggccacagccttcctcgaagacacccaggatccccaagatttacaccaaaacgggagacaaagggttttctagtaccttcacaggagaaaggagacccaaagatgaccaagtgtttgaagccgtgggaactacagatgaattaagttcagctattgggtttgctctggaattagtcacagaaaagggccatacatttgccgaagagcttcagaaaatccagtgcacattgcaggacgtcggctcggccctggcgacaccatgctcctcggcccgggaggctcacttaaagtataccacgttcaaggcggggcccatcctggagctggagcagtggatcgacaagtacaccagccagctcccaccactcacggccttcatcctgccttcgggaggcaagatcagctcggcgctgcatttctgccgggccgtgtgccgccgggccgagagacgtgtggtgcctcttgtccagatgggagagaccgatgcgaacgtggccaagttcttaaacagactcagtgactatctcttcacgctagccagatatgcagccatgaaggaggggaatcaagagaaaatatacatgaaaaatgacccatcggccgagtctgagggactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class II, DR alpha - tumor necrosis factor receptor superfamily, member 9 - potassium voltage-gated channel, subfamily G, member 4 - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) |