MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene View larger

MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011831
Product type: DNA & cDNA
Ncbi symbol: MMAB
Origin species: Human
Product name: MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene
Size: 2ug
Accessions: BC011831
Gene id: 326625
Gene description: methylmalonic aciduria (cobalamin deficiency) cblB type
Synonyms: ATR; CFAP23; cblB; cob; cob(I)yrinic acid a,c-diamide adenosyltransferase, mitochondrial; ATP:cob(I)alamin adenosyltransferase; ATP:corrinoid adenosyltransferase; aquocob(I)alamin vitamin B12s adenosyltransferase; cilia and flagella associated protein 23; methylmalonic aciduria type B protein; methylmalonic aciduria (cobalamin deficiency) cblB type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtgtgcggcctggggagccgtcttggcctggggagccgtcttggcctgcgcgggtgcttcggcgccgccaggctcctgtatccccgtttccagagccgcggccctcagggcgtggaagacggggacaggccacagccttcctcgaagacacccaggatccccaagatttacaccaaaacgggagacaaagggttttctagtaccttcacaggagaaaggagacccaaagatgaccaagtgtttgaagccgtgggaactacagatgaattaagttcagctattgggtttgctctggaattagtcacagaaaagggccatacatttgccgaagagcttcagaaaatccagtgcacattgcaggacgtcggctcggccctggcgacaccatgctcctcggcccgggaggctcacttaaagtataccacgttcaaggcggggcccatcctggagctggagcagtggatcgacaagtacaccagccagctcccaccactcacggccttcatcctgccttcgggaggcaagatcagctcggcgctgcatttctgccgggccgtgtgccgccgggccgagagacgtgtggtgcctcttgtccagatgggagagaccgatgcgaacgtggccaagttcttaaacagactcagtgactatctcttcacgctagccagatatgcagccatgaaggaggggaatcaagagaaaatatacatgaaaaatgacccatcggccgagtctgagggactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DR alpha
- tumor necrosis factor receptor superfamily, member 9
- potassium voltage-gated channel, subfamily G, member 4
- SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)

Buy MMAB-methylmalonic aciduria (cobalamin deficiency) cblB type Gene now

Add to cart