Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFRSF9-tumor necrosis factor receptor superfamily, member 9 Gene
PTXBC006196
New product
Data sheet of TNFRSF9-tumor necrosis factor receptor superfamily, member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFRSF9-tumor necrosis factor receptor superfamily, member 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006196 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFRSF9 |
| Origin species: | Human |
| Product name: | TNFRSF9-tumor necrosis factor receptor superfamily, member 9 Gene |
| Size: | 2ug |
| Accessions: | BC006196 |
| Gene id: | 3604 |
| Gene description: | tumor necrosis factor receptor superfamily, member 9 |
| Synonyms: | 4-1BB; CD137; CDw137; ILA; tumor necrosis factor receptor superfamily member 9; 4-1BB ligand receptor; CD137 antigen; T cell antigen ILA; T-cell antigen 4-1BB homolog; homolog of mouse 4-1BB; induced by lymphocyte activation (ILA); interleukin-activated receptor, homolog of mouse Ly63; receptor protein 4-1BB; TNF receptor superfamily member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaacagctgttacaacatagtagccactctgttgctggtcctcaactttgagaggacaagatcattgcaggatccttgtagtaactgcccagctggtacattctgtgataataacaggaatcagatttgcagtccctgtcctccaaatagtttctccagcgcaggtggacaaaggacctgtgacatatgcaggcagtgtaaaggtgttttcaggaccaggaaggagtgttcctccaccagcaatgcagagtgtgactgcactccagggtttcactgcctgggggcaggatgcagcatgtgtgaacaggattgtaaacaaggtcaagaactgacaaaaaaaggttgtaaagactgttgctttgggacatttaacgatcagaaacgtggcatctgtcgaccctggacaaactgttctttggatggaaagtctgtgcttgtgaatgggacgaaggagagggacgtggtctgtggaccatctccagccgacctctctccgggagcatcctctgtgaccccgcctgcccctgcgagagagccaggacactctccgcagatcatctccttctttcttgcgctgacgtcgactgcgttgctcttcctgctgttcttcctcacgctccgtttctctgttgttaaacggggcagaaagaaactcctgtatatattcaaacaaccatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaagaagaagaaggaggatgtgaactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, subfamily G, member 4 - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) - proteasome (prosome, macropain) subunit, alpha type, 1 - vacuolar protein sorting 37 homolog B (S. cerevisiae) |