PTXBC006196
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC006196 |
Product type: | DNA & cDNA |
Ncbi symbol: | TNFRSF9 |
Origin species: | Human |
Product name: | TNFRSF9-tumor necrosis factor receptor superfamily, member 9 Gene |
Size: | 2ug |
Accessions: | BC006196 |
Gene id: | 3604 |
Gene description: | tumor necrosis factor receptor superfamily, member 9 |
Synonyms: | 4-1BB; CD137; CDw137; ILA; tumor necrosis factor receptor superfamily member 9; 4-1BB ligand receptor; CD137 antigen; T cell antigen ILA; T-cell antigen 4-1BB homolog; homolog of mouse 4-1BB; induced by lymphocyte activation (ILA); interleukin-activated receptor, homolog of mouse Ly63; receptor protein 4-1BB; TNF receptor superfamily member 9 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggaaacagctgttacaacatagtagccactctgttgctggtcctcaactttgagaggacaagatcattgcaggatccttgtagtaactgcccagctggtacattctgtgataataacaggaatcagatttgcagtccctgtcctccaaatagtttctccagcgcaggtggacaaaggacctgtgacatatgcaggcagtgtaaaggtgttttcaggaccaggaaggagtgttcctccaccagcaatgcagagtgtgactgcactccagggtttcactgcctgggggcaggatgcagcatgtgtgaacaggattgtaaacaaggtcaagaactgacaaaaaaaggttgtaaagactgttgctttgggacatttaacgatcagaaacgtggcatctgtcgaccctggacaaactgttctttggatggaaagtctgtgcttgtgaatgggacgaaggagagggacgtggtctgtggaccatctccagccgacctctctccgggagcatcctctgtgaccccgcctgcccctgcgagagagccaggacactctccgcagatcatctccttctttcttgcgctgacgtcgactgcgttgctcttcctgctgttcttcctcacgctccgtttctctgttgttaaacggggcagaaagaaactcctgtatatattcaaacaaccatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaagaagaagaaggaggatgtgaactgtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - potassium voltage-gated channel, subfamily G, member 4 - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) - proteasome (prosome, macropain) subunit, alpha type, 1 - vacuolar protein sorting 37 homolog B (S. cerevisiae) |