HLA-DRA-major histocompatibility complex, class II, DR alpha Gene View larger

HLA-DRA-major histocompatibility complex, class II, DR alpha Gene

PTXBC032350

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DRA-major histocompatibility complex, class II, DR alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DRA-major histocompatibility complex, class II, DR alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032350
Product type: DNA & cDNA
Ncbi symbol: HLA-DRA
Origin species: Human
Product name: HLA-DRA-major histocompatibility complex, class II, DR alpha Gene
Size: 2ug
Accessions: BC032350
Gene id: 3122
Gene description: major histocompatibility complex, class II, DR alpha
Synonyms: HLA-DRA1; HLA class II histocompatibility antigen, DR alpha chain; MHC class II antigen DRA; histocompatibility antigen HLA-DR alpha; major histocompatibility complex, class II, DR alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccataagtggagtccctgtgctaggatttttcatcatagctgtgctgatgagcgctcaggaatcatgggctatcaaagaagaacatgtgatcatccaggccgagttctatctgaatcctgaccaatcaggcgagtttatgtttgactttgatggtgatgagattttccatgtggatatggcaaagaaggagacggtctggcggcttgaagaatttggacgatttgccagctttgaggctcaaggtgcattggccaacatagctgtggacaaagccaacctggaaatcatgacaaagcgctccaactatactccgatcaccaatgtacctccagaggtaactgtgctcacgaacagccctgtggaactgagagagcccaacgtcctcatctgtttcatagacaagttcaccccaccagtggtcaatgtcacgtggcttcgaaatggaaaacctgtcaccacaggagtgtcagagacagtcttcctgcccagggaagaccaccttttccgcaagttccactatctccccttcctgccctcaactgaggacgtttacgactgcagggtggagcactggggcttggatgagcctcttctcaagcactgggagtttgatgctccaagccctctcccagagactacagagaacgtggtgtgtgccctgggcctgactgtgggtctggtgggcatcattattgggaccatcttcatcatcaagggattgcgcaaaagcaatgcagcagaacgcagggggcctctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor receptor superfamily, member 9
- potassium voltage-gated channel, subfamily G, member 4
- SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
- proteasome (prosome, macropain) subunit, alpha type, 1

Buy HLA-DRA-major histocompatibility complex, class II, DR alpha Gene now

Add to cart