THAP1-THAP domain containing, apoptosis associated protein 1 Gene View larger

THAP1-THAP domain containing, apoptosis associated protein 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THAP1-THAP domain containing, apoptosis associated protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about THAP1-THAP domain containing, apoptosis associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021721
Product type: DNA & cDNA
Ncbi symbol: THAP1
Origin species: Human
Product name: THAP1-THAP domain containing, apoptosis associated protein 1 Gene
Size: 2ug
Accessions: BC021721
Gene id: 55145
Gene description: THAP domain containing, apoptosis associated protein 1
Synonyms: DYT6; THAP domain-containing protein 1; 4833431A01Rik; THAP domain containing, apoptosis associated protein 1; THAP domain protein 1; nuclear proapoptotic factor; THAP domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcagtcctgctccgcctacggctgcaagaaccgctacgacaaggacaagcccgtttctttccacaagtttcctcttactcgacccagtctttgtaaagaatgggaggcagctgtcagaagaaaaaactttaaacccaccaagtatagcagtatttgttcagagcactttactccagactgctttaagagagagtgcaacaacaagttactgaaagagaatgctgtgcccacaatatttctttgtactgagccacatgacaagaaagaagatcttctggagccacaggaacagcttcccccacctcctttaccgcctcctgtttcccaggttgatgctgctattggattactaatgccgcctcttcagacccctgttaatctctcagttttctgtgaccacaactatactgtggaggatacaatgcaccagcggaaaaggattcatcagctagaacagcaagttgaaaaactcagaaagaagctcaagaccgcacagcagcgatgcagaaggcaagaacggcagcttgaaaaattaaaggaggttgttcacttccagaaagagaaagacgacgtatcagaaagaggttatgtgattctaccaaatgactactttgaaatagttgaagtaccagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation-like factor 6 interacting protein 4
- ADP-ribosylation-like factor 6 interacting protein 6
- proteasome (prosome, macropain) subunit, alpha type, 8
- proteasome (prosome, macropain) subunit, alpha type, 6

Buy THAP1-THAP domain containing, apoptosis associated protein 1 Gene now

Add to cart