Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
THAP1-THAP domain containing, apoptosis associated protein 1 Gene
PTXBC021721
New product
Data sheet of THAP1-THAP domain containing, apoptosis associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about THAP1-THAP domain containing, apoptosis associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021721 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | THAP1 |
| Origin species: | Human |
| Product name: | THAP1-THAP domain containing, apoptosis associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC021721 |
| Gene id: | 55145 |
| Gene description: | THAP domain containing, apoptosis associated protein 1 |
| Synonyms: | DYT6; THAP domain-containing protein 1; 4833431A01Rik; THAP domain containing, apoptosis associated protein 1; THAP domain protein 1; nuclear proapoptotic factor; THAP domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgcagtcctgctccgcctacggctgcaagaaccgctacgacaaggacaagcccgtttctttccacaagtttcctcttactcgacccagtctttgtaaagaatgggaggcagctgtcagaagaaaaaactttaaacccaccaagtatagcagtatttgttcagagcactttactccagactgctttaagagagagtgcaacaacaagttactgaaagagaatgctgtgcccacaatatttctttgtactgagccacatgacaagaaagaagatcttctggagccacaggaacagcttcccccacctcctttaccgcctcctgtttcccaggttgatgctgctattggattactaatgccgcctcttcagacccctgttaatctctcagttttctgtgaccacaactatactgtggaggatacaatgcaccagcggaaaaggattcatcagctagaacagcaagttgaaaaactcagaaagaagctcaagaccgcacagcagcgatgcagaaggcaagaacggcagcttgaaaaattaaaggaggttgttcacttccagaaagagaaagacgacgtatcagaaagaggttatgtgattctaccaaatgactactttgaaatagttgaagtaccagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation-like factor 6 interacting protein 4 - ADP-ribosylation-like factor 6 interacting protein 6 - proteasome (prosome, macropain) subunit, alpha type, 8 - proteasome (prosome, macropain) subunit, alpha type, 6 |