Login to display prices
Login to display prices
PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene View larger

PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008188
Product type: DNA & cDNA
Ncbi symbol: PARK7
Origin species: Human
Product name: PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene
Size: 2ug
Accessions: BC008188
Gene id: 11315
Gene description: Parkinson disease (autosomal recessive, early onset) 7
Synonyms: DJ-1; DJ1; HEL-S-67p; protein deglycase DJ-1; Parkinson disease (autosomal recessive, early onset) 7; epididymis secretory sperm binding protein Li 67p; oncogene DJ1; parkinson protein 7; protein DJ-1; Parkinsonism associated deglycase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccaaaagagctctggtcatcctggctaaaggagcagaggaaatggagacggtcatccctgtagatgtcatgaggcgagctgggattaaggtcaccgttgcaggcctggctggaaaagacccagtacagtgtagccgtgatgtggtcatttgtcctgatgccagccttgaagatgcaaaaaaagagggaccatatgatgtggtggttctaccaggaggtaatctgggtgcacagaatttatctgagtctgctgctgtgaaggagatactgaaggagcaggaaaaccggaagggcctgatagccgccatctgtgcaggtcctactgctctgttggctcatgaaataggttttggaagtaaagttacaacacaccctcttgctaaagacaaaatgatgaatggaggtcattacacctactctgagaatcgtgtggaaaaagacggcctgattcttacaagccgggggcctgggaccagcttcgagtttgcgcttgcaattgttgaagccctgaatggcaaggaggtggcggctcaagtgaaggctccacttgttcttaaagactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - killer cell lectin-like receptor subfamily G, member 1
- proteasome (prosome, macropain) subunit, alpha type, 8
- THAP domain containing, apoptosis associated protein 1
- ADP-ribosylation-like factor 6 interacting protein 4