Login to display prices
Login to display prices
UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene View larger

UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006277
Product type: DNA & cDNA
Ncbi symbol: UBE2H
Origin species: Human
Product name: UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene
Size: 2ug
Accessions: BC006277
Gene id: 7328
Gene description: ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast)
Synonyms: E2-20K; GID3; UBC8; UBCH; UBCH2; ubiquitin-conjugating enzyme E2 H; (E3-independent) E2 ubiquitin-conjugating enzyme H; E2 ubiquitin-conjugating enzyme H; GID complex subunit 3, UBC8 homolog; ubiquitin carrier protein H; ubiquitin conjugating enzyme E2H; ubiquitin-conjugating enzyme E2-20K; ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast); ubiquitin-conjugating enzyme E2H (homologous to yeast UBC8); ubiquitin-protein ligase H; ubiquitin conjugating enzyme E2 H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcatctcccagtccgggcaagaggcggatggacacggacgtggtcaagctcatcgagagtaaacatgaggttacgatcctgggaggacttaatgaatttgtagtgaagttttatggaccacaaggaacaccatatgaaggcggagtatggaaagttagagtggacctacctgataaataccctttcaaatctccatctataggattcatgaataaaattttccatcccaacattgatgaagcgtcaggaactgtgtgtctagatgtaattaatcaaacttggacagctctctatgatcttaccaatatatttgagtccttcctgcctcagttattggcctatcctaaccccatagatcctctcaatggtgacgctgcagccatgtacctccaccgaccagaagaatacaagcagaaaattaaagagtacatccagaaatacgccacggaggaggcgctgaaagaacaggaagagggtaccggggacagctcatcggagagctctatgtctgacttttccgaagatgaggcccaggatatggagttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)
- Parkinson disease (autosomal recessive, early onset) 7
- killer cell lectin-like receptor subfamily G, member 1
- proteasome (prosome, macropain) subunit, alpha type, 8