Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene
PTXBC006277
New product
Data sheet of UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006277 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2H |
| Origin species: | Human |
| Product name: | UBE2H-ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC006277 |
| Gene id: | 7328 |
| Gene description: | ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) |
| Synonyms: | E2-20K; GID3; UBC8; UBCH; UBCH2; ubiquitin-conjugating enzyme E2 H; (E3-independent) E2 ubiquitin-conjugating enzyme H; E2 ubiquitin-conjugating enzyme H; GID complex subunit 3, UBC8 homolog; ubiquitin carrier protein H; ubiquitin conjugating enzyme E2H; ubiquitin-conjugating enzyme E2-20K; ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast); ubiquitin-conjugating enzyme E2H (homologous to yeast UBC8); ubiquitin-protein ligase H; ubiquitin conjugating enzyme E2 H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcatctcccagtccgggcaagaggcggatggacacggacgtggtcaagctcatcgagagtaaacatgaggttacgatcctgggaggacttaatgaatttgtagtgaagttttatggaccacaaggaacaccatatgaaggcggagtatggaaagttagagtggacctacctgataaataccctttcaaatctccatctataggattcatgaataaaattttccatcccaacattgatgaagcgtcaggaactgtgtgtctagatgtaattaatcaaacttggacagctctctatgatcttaccaatatatttgagtccttcctgcctcagttattggcctatcctaaccccatagatcctctcaatggtgacgctgcagccatgtacctccaccgaccagaagaatacaagcagaaaattaaagagtacatccagaaatacgccacggaggaggcgctgaaagaacaggaagagggtaccggggacagctcatcggagagctctatgtctgacttttccgaagatgaggcccaggatatggagttgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) - Parkinson disease (autosomal recessive, early onset) 7 - killer cell lectin-like receptor subfamily G, member 1 - proteasome (prosome, macropain) subunit, alpha type, 8 |