Login to display prices
Login to display prices
COMMD8-COMM domain containing 8 Gene View larger

COMMD8-COMM domain containing 8 Gene

PTXBC019826

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COMMD8-COMM domain containing 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COMMD8-COMM domain containing 8 Gene

Proteogenix catalog: PTXBC019826
Ncbi symbol: COMMD8
Product name: COMMD8-COMM domain containing 8 Gene
Size: 2ug
Accessions: BC019826
Gene id: 54951
Gene description: COMM domain containing 8
Synonyms: COMM domain-containing protein 8; COMM domain containing 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccggaagaggggacgcccttgtggcggctgcagaagctgccggccgagctgggcccgcagcttcttcacaaaataattgatggcatttgtggtcgagcttatcctgtgtaccaagattatcacactgtttgggaatcagaagaatggatgcacgttttagaagatattgccaaatttttcaaagccatagttggtaaaaacttacctgatgaagagatatttcagcagttgaatcagttgaattcacttcatcaagaaactatcatgaaatgcgtgaaaagtaggaaagatgaaatcaaacaggctctgtcaagagaaatagttgctatttcctctgcacagctacaggattttgattggcaggtaaagcttctactttccagtgacaagattgctgcattacgaatgccacttttaagcctgcatctagatgtaaaagaaaatggtgaagtaaaaccttattctattgaaatgagtagagaggagctgcagaatctaatacagtccttggaagcagcgaataaggtggtcctgcagttgaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice