RNF208-ring finger protein 208 Gene View larger

RNF208-ring finger protein 208 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF208-ring finger protein 208 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RNF208-ring finger protein 208 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016958
Product type: DNA & cDNA
Ncbi symbol: RNF208
Origin species: Human
Product name: RNF208-ring finger protein 208 Gene
Size: 2ug
Accessions: BC016958
Gene id: 727800
Gene description: ring finger protein 208
Synonyms: RING finger protein 208
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgccttggaaggggcaccccataccccgccactgccacggcggccccgtaagggaagctcggagctgggctttccccgcgtggccccagaggatgaggtcattgtgaatcagtacgtgattcggcctggcccctcggcctcggcggcttcttcggcggcggcaggcgagcccctggagtgccccacctgtgggcactcctacaatgtcacccagcggaggccccgcgtgctgtcctgcctgcactctgtgtgtgagcagtgcctgcagattctctacgagtcctgccccaagtacaagttcatctcctgccccacctgccgccgtgagactgtgctcttcaccgactacggcctggccgcgctggctgtcaacacgtccatcctgagccgcctgccgcctgaggcgctgacggccccatccgggggtcagtggggggctgagcccgagggcagctgctaccagaccttccggcagtactgtggggccgcgtgcacctgccacgtgcggaacccactgtccgcctgctccatcatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 655
- zinc finger protein 614
- uridine-cytidine kinase 1
- ankyrin repeat domain 7

Buy RNF208-ring finger protein 208 Gene now

Add to cart