Login to display prices
Login to display prices
RNF208-ring finger protein 208 Gene View larger

RNF208-ring finger protein 208 Gene

PTXBC016958

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF208-ring finger protein 208 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF208-ring finger protein 208 Gene

Proteogenix catalog: PTXBC016958
Ncbi symbol: RNF208
Product name: RNF208-ring finger protein 208 Gene
Size: 2ug
Accessions: BC016958
Gene id: 727800
Gene description: ring finger protein 208
Synonyms: RING finger protein 208
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgccttggaaggggcaccccataccccgccactgccacggcggccccgtaagggaagctcggagctgggctttccccgcgtggccccagaggatgaggtcattgtgaatcagtacgtgattcggcctggcccctcggcctcggcggcttcttcggcggcggcaggcgagcccctggagtgccccacctgtgggcactcctacaatgtcacccagcggaggccccgcgtgctgtcctgcctgcactctgtgtgtgagcagtgcctgcagattctctacgagtcctgccccaagtacaagttcatctcctgccccacctgccgccgtgagactgtgctcttcaccgactacggcctggccgcgctggctgtcaacacgtccatcctgagccgcctgccgcctgaggcgctgacggccccatccgggggtcagtggggggctgagcccgagggcagctgctaccagaccttccggcagtactgtggggccgcgtgcacctgccacgtgcggaacccactgtccgcctgctccatcatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice