Login to display prices
Login to display prices
ZNF614-zinc finger protein 614 Gene View larger

ZNF614-zinc finger protein 614 Gene

PTXBC004930

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF614-zinc finger protein 614 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF614-zinc finger protein 614 Gene

Proteogenix catalog: PTXBC004930
Ncbi symbol: ZNF614
Product name: ZNF614-zinc finger protein 614 Gene
Size: 2ug
Accessions: BC004930
Gene id: 80110
Gene description: zinc finger protein 614
Synonyms: zinc finger protein 614
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcaagacccaggaatcactgaccctggaggatgtggctgtggaattcagctgggaggagtggcagctcctggacactgctcagaagaacctgtaccgggatgtgatggtggagaactataaccacctagtatcactggggtatcaaactagcaaaccagatgtactctccaagttggcacatggacaagaaccatggacaacagatgctaaaattcagaataaaaattgtccaggaatcgggaaagttgacagtcatctgcaagagcactctccaaaccaaagacttctgaagagcgtgcagcaatgcaatggacagaatacacttagaaatattgtacatctcagcaagacacattttcctatagtgcaaaatcatgatacatttgacttgtacagaaaaaatttgaaatcaagtttaagtttaatcaaccagaagagaagacatggaataaataaccctgttgagtttattggagagacagggtctcttgagaggccgaggcaggcggatcacttgaggtcagaagttcaagaccagcctggccaacgtggcgaaaccctgtgtctactaaaaatacacacaaaaaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice