ANKRD7-ankyrin repeat domain 7 Gene View larger

ANKRD7-ankyrin repeat domain 7 Gene

PTXBC032799

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKRD7-ankyrin repeat domain 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANKRD7-ankyrin repeat domain 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032799
Product type: DNA & cDNA
Ncbi symbol: ANKRD7
Origin species: Human
Product name: ANKRD7-ankyrin repeat domain 7 Gene
Size: 2ug
Accessions: BC032799
Gene id: 56311
Gene description: ankyrin repeat domain 7
Synonyms: ankyrin repeat domain-containing protein 7; testicular tissue protein Li 19; testis-specific ankyrin motif containing protein; testis-specific protein TSA806; ankyrin repeat domain 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggacaaaaaatacagaacacctttgcacctagcctgtgctaatggacatacagatgttgtacttttcctaattgagcaacaatgcaaaataaatgtccgggatagtgaaaacaaatccccattgattaaggcagtacagtgtcaaaatgaggattgtgctactattcttctaaactttggtgcagacccagatctgagggatattcgttataatactgttcttcactatgctgtttgtggtcaaagtttgtcattagttgaaaaactgcttgaatacgaagctgatcttgaagcgaaaaataaggatgggtatactccactattagttgccgttattaacaataatccaaaaatggtaaaatttcttctggagaaaggggctgatgtgaatgcttcagataattatcaaagaacagcccttattcttgctgtcagtggtgaaccaccatgtttagtaaagcttcttcttcagcaaggtgtggaattatgttacgaaggtattgtggattcacagctgaggaatatgtttatttccatggttttactgcatagatacccacaattcactgcgagccatggaaagaagaaacatgctaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - opioid receptor, sigma 1
- ring finger protein 138
- zinc finger protein 509
- zinc finger protein 434

Buy ANKRD7-ankyrin repeat domain 7 Gene now

Add to cart