Login to display prices
Login to display prices
UCK1-uridine-cytidine kinase 1 Gene View larger

UCK1-uridine-cytidine kinase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UCK1-uridine-cytidine kinase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UCK1-uridine-cytidine kinase 1 Gene

Proteogenix catalog: PTXBC015547
Ncbi symbol: UCK1
Product name: UCK1-uridine-cytidine kinase 1 Gene
Size: 2ug
Accessions: BC015547
Gene id: 83549
Gene description: uridine-cytidine kinase 1
Synonyms: URK1; uridine-cytidine kinase 1; cytidine monophosphokinase 1; uridine monophosphokinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcggcgggaggcgaagactgcgagagccccgcgccggaggccgaccgtccgcaccagcggcccttcctgataggggtgagcggcggcactgccagcgggaagtcgaccgtgtgtgagaagatcatggagttgctgggacagaacgaggtggaacagcggcagcggaaggtggtcatcctgagccaggacaggttctacaaggtcctgacggcagagcagaaggccaaggccttgaaaggacagtacaattttgaccatccagatgcctttgataatgatttgatgcacaggactctgaagaacatcgtggagggcaaaacggtggaggtgccgacctatgattttgtgacacactcaaggttaccagagaccacggtggtctaccctgcggacgtggttctgtttgagggcatcttggtgttctacagccaggagatccgggacatgttccacctgcgcctcttcgtggacaccgactccgacgtcaggctgtctcgaagagacaaagaagtatgccgatgtgatcatcccacgaggagtggacaatatggttgccatcaacctgatcgtgcagcacatccaggacattctgaatggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: