UCK1-uridine-cytidine kinase 1 Gene View larger

UCK1-uridine-cytidine kinase 1 Gene

PTXBC015547

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UCK1-uridine-cytidine kinase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UCK1-uridine-cytidine kinase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015547
Product type: DNA & cDNA
Ncbi symbol: UCK1
Origin species: Human
Product name: UCK1-uridine-cytidine kinase 1 Gene
Size: 2ug
Accessions: BC015547
Gene id: 83549
Gene description: uridine-cytidine kinase 1
Synonyms: URK1; uridine-cytidine kinase 1; cytidine monophosphokinase 1; uridine monophosphokinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcggcgggaggcgaagactgcgagagccccgcgccggaggccgaccgtccgcaccagcggcccttcctgataggggtgagcggcggcactgccagcgggaagtcgaccgtgtgtgagaagatcatggagttgctgggacagaacgaggtggaacagcggcagcggaaggtggtcatcctgagccaggacaggttctacaaggtcctgacggcagagcagaaggccaaggccttgaaaggacagtacaattttgaccatccagatgcctttgataatgatttgatgcacaggactctgaagaacatcgtggagggcaaaacggtggaggtgccgacctatgattttgtgacacactcaaggttaccagagaccacggtggtctaccctgcggacgtggttctgtttgagggcatcttggtgttctacagccaggagatccgggacatgttccacctgcgcctcttcgtggacaccgactccgacgtcaggctgtctcgaagagacaaagaagtatgccgatgtgatcatcccacgaggagtggacaatatggttgccatcaacctgatcgtgcagcacatccaggacattctgaatggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat domain 7
- opioid receptor, sigma 1
- ring finger protein 138
- zinc finger protein 509

Buy UCK1-uridine-cytidine kinase 1 Gene now

Add to cart