ZNF655-zinc finger protein 655 Gene View larger

ZNF655-zinc finger protein 655 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF655-zinc finger protein 655 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF655-zinc finger protein 655 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000823
Product type: DNA & cDNA
Ncbi symbol: ZNF655
Origin species: Human
Product name: ZNF655-zinc finger protein 655 Gene
Size: 2ug
Accessions: BC000823
Gene id: 79027
Gene description: zinc finger protein 655
Synonyms: VIK-1; zinc finger protein 655; vav-1 interacting Kruppel-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaaataccagcccaggaagcagcagggtcaccaagggtccagtttcagtctttggagacccagtctgagtgtctgtccccagagcctcagtttgtgcaggacaccgacatggaacagggactcactggggctccacctgttcctcaggtgcctgctcttccccgtgagggaagcccaggagaccaggcagctgcgctcttgacagccaggtaccaggagtttgtgacattcgaggatgtggctgtgcaccttactcgagaggaatggggatacctggaccctgttcagagggacctctacagagaagtgatgttagagaattatgggaacgtggtctcactgggcatacttctccgccttcccaccacccggattcatagtgtgaattcctgcccggccctgagtcatacccaggcaagtgctttctctggagaaacacttgccgtccttacagcaggaatctccaagagatggcccaagtatcggcttcccatcgatattgctcgtccctgctcggaaactccttttccacgattgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 614
- uridine-cytidine kinase 1
- ankyrin repeat domain 7
- opioid receptor, sigma 1

Buy ZNF655-zinc finger protein 655 Gene now

Add to cart