Login to display prices
Login to display prices
ZNF655-zinc finger protein 655 Gene View larger

ZNF655-zinc finger protein 655 Gene

PTXBC000823

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF655-zinc finger protein 655 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF655-zinc finger protein 655 Gene

Proteogenix catalog: PTXBC000823
Ncbi symbol: ZNF655
Product name: ZNF655-zinc finger protein 655 Gene
Size: 2ug
Accessions: BC000823
Gene id: 79027
Gene description: zinc finger protein 655
Synonyms: VIK-1; zinc finger protein 655; vav-1 interacting Kruppel-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaaataccagcccaggaagcagcagggtcaccaagggtccagtttcagtctttggagacccagtctgagtgtctgtccccagagcctcagtttgtgcaggacaccgacatggaacagggactcactggggctccacctgttcctcaggtgcctgctcttccccgtgagggaagcccaggagaccaggcagctgcgctcttgacagccaggtaccaggagtttgtgacattcgaggatgtggctgtgcaccttactcgagaggaatggggatacctggaccctgttcagagggacctctacagagaagtgatgttagagaattatgggaacgtggtctcactgggcatacttctccgccttcccaccacccggattcatagtgtgaattcctgcccggccctgagtcatacccaggcaagtgctttctctggagaaacacttgccgtccttacagcaggaatctccaagagatggcccaagtatcggcttcccatcgatattgctcgtccctgctcggaaactccttttccacgattgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice