Login to display prices
Login to display prices
ARF4-ADP-ribosylation factor 4 Gene View larger

ARF4-ADP-ribosylation factor 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARF4-ADP-ribosylation factor 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARF4-ADP-ribosylation factor 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003364
Product type: DNA & cDNA
Ncbi symbol: ARF4
Origin species: Human
Product name: ARF4-ADP-ribosylation factor 4 Gene
Size: 2ug
Accessions: BC003364
Gene id: 378
Gene description: ADP-ribosylation factor 4
Synonyms: ARF2; ADP-ribosylation factor 4; ADP-ribosylation factor 2; ADP ribosylation factor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctcactatctcctccctcttctcccgactatttggcaagaagcagatgcgcattttgatggttggattggatgctgctggcaagacaaccattctgtataaactgaagttaggggagatagtcaccaccattcctaccattggttttaatgtggaaacagtagaatataagaacatttgtttcacagtatgggatgttggtggtcaagatagaattaggcctctctggaagcattacttccagaatacccagggtcttatttttgtggtagatagcaacgatcgtgaaagaattcaggaagtagcagatgagctgcagaaaatgcttctggtagatgaattgagagatgcagtgctgctactttttgcaaacaaacaggatttgccaaatgctatggccatcagtgaaatgacagataaactagggcttcagtctcttcgtaacagaacatggtatgttcaagccacttgtgcaacacaaggaactggtctgtatgaaggacttgactggctgtcaaatgagctttcaaaacgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 208
- zinc finger protein 655
- zinc finger protein 614
- uridine-cytidine kinase 1