UBE2C-ubiquitin-conjugating enzyme E2C Gene View larger

UBE2C-ubiquitin-conjugating enzyme E2C Gene

PTXBC007656

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2C-ubiquitin-conjugating enzyme E2C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2C-ubiquitin-conjugating enzyme E2C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007656
Product type: DNA & cDNA
Ncbi symbol: UBE2C
Origin species: Human
Product name: UBE2C-ubiquitin-conjugating enzyme E2C Gene
Size: 2ug
Accessions: BC007656
Gene id: 11065
Gene description: ubiquitin-conjugating enzyme E2C
Synonyms: UBCH10; dJ447F3.2; ubiquitin-conjugating enzyme E2 C; (E3-independent) E2 ubiquitin-conjugating enzyme C; E2 ubiquitin-conjugating enzyme C; cyclin-selective ubiquitin carrier protein; mitotic-specific ubiquitin-conjugating enzyme; ubiquitin conjugating enzyme E2C; ubiquitin-protein ligase C; ubiquitin conjugating enzyme E2 C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcccaaaaccgcgacccagccgccactagcgtcgccgccgcccgtaaaggagctgagccgagcgggggcgccgcccggggtccggtgggcaaaaggctacagcaggagctgatgaccctcatgatgtctggcgataaagggatttctgccttccctgaatcagacaaccttttcaaatgggtagggaccatccatggagcagctggaacagtatatgaagacctgaggtataagctctcgctagagttccccagtggctacccttacaatgcgcccacagtgaagttcctcacgccctgctatcaccccaacgtggacacccagggtaacatatgcctggacatcctgaaggaaaagtggtctgccctgtatgatgtcaggaccattctgctctccatccagagccttctaggagaacccaacattgatagtcccttgaacacacatgctgccgagctctggaaaaaccccacagcttttaagaagtacctgcaagaaacctactcaaagcaggtcaccagccaggagccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - retinoblastoma binding protein 9
- hypothetical protein MGC16385
- interleukin 6 (interferon, beta 2)
- gypsy retrotransposon integrase 1

Buy UBE2C-ubiquitin-conjugating enzyme E2C Gene now

Add to cart