Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 185,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 185,00 €
Data sheet of UBE2C-ubiquitin-conjugating enzyme E2C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2C-ubiquitin-conjugating enzyme E2C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007656 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2C |
| Origin species: | Human |
| Product name: | UBE2C-ubiquitin-conjugating enzyme E2C Gene |
| Size: | 2ug |
| Accessions: | BC007656 |
| Gene id: | 11065 |
| Gene description: | ubiquitin-conjugating enzyme E2C |
| Synonyms: | UBCH10; dJ447F3.2; ubiquitin-conjugating enzyme E2 C; (E3-independent) E2 ubiquitin-conjugating enzyme C; E2 ubiquitin-conjugating enzyme C; cyclin-selective ubiquitin carrier protein; mitotic-specific ubiquitin-conjugating enzyme; ubiquitin conjugating enzyme E2C; ubiquitin-protein ligase C; ubiquitin conjugating enzyme E2 C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttcccaaaaccgcgacccagccgccactagcgtcgccgccgcccgtaaaggagctgagccgagcgggggcgccgcccggggtccggtgggcaaaaggctacagcaggagctgatgaccctcatgatgtctggcgataaagggatttctgccttccctgaatcagacaaccttttcaaatgggtagggaccatccatggagcagctggaacagtatatgaagacctgaggtataagctctcgctagagttccccagtggctacccttacaatgcgcccacagtgaagttcctcacgccctgctatcaccccaacgtggacacccagggtaacatatgcctggacatcctgaaggaaaagtggtctgccctgtatgatgtcaggaccattctgctctccatccagagccttctaggagaacccaacattgatagtcccttgaacacacatgctgccgagctctggaaaaaccccacagcttttaagaagtacctgcaagaaacctactcaaagcaggtcaccagccaggagccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - retinoblastoma binding protein 9 - hypothetical protein MGC16385 - interleukin 6 (interferon, beta 2) - gypsy retrotransposon integrase 1 |