NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene View larger

NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007672
Product type: DNA & cDNA
Ncbi symbol: NDUFB9
Origin species: Human
Product name: NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene
Size: 2ug
Accessions: BC007672
Gene id: 4715
Gene description: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Synonyms: B22; CI-B22; LYRM3; UQOR22; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 9; LYR motif-containing protein 3; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa; NADH-ubiquinone oxidoreductase B22 subunit; complex I B22 subunit; NADH:ubiquinone oxidoreductase subunit B9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttcttggcgtcgggaccctacctgacccatcagcaaaaggtgttgcggctttataagcgggcgctacgccacctcgagtcgtggtgcgtccagagagacaaataccgatactttgcttgtttgatgagagcccggtttgaagaacataagaatgaaaaggatatggcgaaggccacccagctgctgaaggaggccgaggaagaattctggtaccgtcagcatccacagccatacatcttccctgactctcctgggggcacctcctatgagagatacgattgctacaaggtcccagaatggtgcttagatgactggcatccttctgagaaggcaatgtatcctgattactttgccaagagagaacagtggaagaaactgcggagggaaagctgggaacgagaggttaagcagctgcaggaggaaacgccacctggtggtcctttaactgaagctttgccccctgcccgaaaggaaggtgatttgcccccactgtggtggtatattgtgaccagaccccgggagcggcccatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myosin, light chain 6B, alkali, smooth muscle and non-muscle
- phosphatidic acid phosphatase type 2 domain containing 1B
- eukaryotic translation initiation factor 4E family member 2
- SEC22 vesicle trafficking protein homolog C (S. cerevisiae)

Buy NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene now

Add to cart