Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene
PTXBC007672
New product
Data sheet of NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007672 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFB9 |
| Origin species: | Human |
| Product name: | NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene |
| Size: | 2ug |
| Accessions: | BC007672 |
| Gene id: | 4715 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa |
| Synonyms: | B22; CI-B22; LYRM3; UQOR22; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 9; LYR motif-containing protein 3; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa; NADH-ubiquinone oxidoreductase B22 subunit; complex I B22 subunit; NADH:ubiquinone oxidoreductase subunit B9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgttcttggcgtcgggaccctacctgacccatcagcaaaaggtgttgcggctttataagcgggcgctacgccacctcgagtcgtggtgcgtccagagagacaaataccgatactttgcttgtttgatgagagcccggtttgaagaacataagaatgaaaaggatatggcgaaggccacccagctgctgaaggaggccgaggaagaattctggtaccgtcagcatccacagccatacatcttccctgactctcctgggggcacctcctatgagagatacgattgctacaaggtcccagaatggtgcttagatgactggcatccttctgagaaggcaatgtatcctgattactttgccaagagagaacagtggaagaaactgcggagggaaagctgggaacgagaggttaagcagctgcaggaggaaacgccacctggtggtcctttaactgaagctttgccccctgcccgaaaggaaggtgatttgcccccactgtggtggtatattgtgaccagaccccgggagcggcccatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin, light chain 6B, alkali, smooth muscle and non-muscle - phosphatidic acid phosphatase type 2 domain containing 1B - eukaryotic translation initiation factor 4E family member 2 - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) |