Login to display prices
Login to display prices
NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene View larger

NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene

PTXBC007672

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene

Proteogenix catalog: PTXBC007672
Ncbi symbol: NDUFB9
Product name: NDUFB9-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa Gene
Size: 2ug
Accessions: BC007672
Gene id: 4715
Gene description: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
Synonyms: B22; CI-B22; LYRM3; UQOR22; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 9; LYR motif-containing protein 3; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa; NADH-ubiquinone oxidoreductase B22 subunit; complex I B22 subunit; NADH:ubiquinone oxidoreductase subunit B9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttcttggcgtcgggaccctacctgacccatcagcaaaaggtgttgcggctttataagcgggcgctacgccacctcgagtcgtggtgcgtccagagagacaaataccgatactttgcttgtttgatgagagcccggtttgaagaacataagaatgaaaaggatatggcgaaggccacccagctgctgaaggaggccgaggaagaattctggtaccgtcagcatccacagccatacatcttccctgactctcctgggggcacctcctatgagagatacgattgctacaaggtcccagaatggtgcttagatgactggcatccttctgagaaggcaatgtatcctgattactttgccaagagagaacagtggaagaaactgcggagggaaagctgggaacgagaggttaagcagctgcaggaggaaacgccacctggtggtcctttaactgaagctttgccccctgcccgaaaggaaggtgatttgcccccactgtggtggtatattgtgaccagaccccgggagcggcccatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice