Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF4E2-eukaryotic translation initiation factor 4E family member 2 Gene
PTXBC005392
New product
Data sheet of EIF4E2-eukaryotic translation initiation factor 4E family member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF4E2-eukaryotic translation initiation factor 4E family member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005392 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4E2 |
| Origin species: | Human |
| Product name: | EIF4E2-eukaryotic translation initiation factor 4E family member 2 Gene |
| Size: | 2ug |
| Accessions: | BC005392 |
| Gene id: | 9470 |
| Gene description: | eukaryotic translation initiation factor 4E family member 2 |
| Synonyms: | 4E-LP; 4EHP; EIF4EL3; IF4e; eukaryotic translation initiation factor 4E type 2; eIF-4E type 2; eIF4E-like cap-binding protein; eIF4E-like protein 4E-LP; eukaryotic translation initiation factor 4E homologous protein; eukaryotic translation initiation factor 4E-like 3; mRNA cap-binding protein type 3; eukaryotic translation initiation factor 4E family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacaacaagttcgacgctttgaaagatgatgacagtggggaccatgatcagaatgaagaaaacagcacacagaaagatggtgagaaggaaaaaacggaacgagacaagaatcagagcagtagcaagagaaaggctgttgtccctggaccggcagagcatcccctgcagtacaactacactttttggtactccaggagaacccccggccgtcccacgagctcacagagctatgaacagaatatcaaacagattggcacctttgcctctgtggagcagttctggaggttttatagccacatggtacgtcctggggacctgacaggccacagtgacttccatctcttcaaagaaggaattaaacccatgtgggaggatgatgcaaataaaaatggtggcaagtggattattcggctgcggaagggcttggcctcccgttgctgggagaatctcattttggccatgctgggggaacagttcatggttggggaggagatctgtggggctgtggtgtctgtccgctttcaggaagacattatttcaatatggaataagactgccagtgaccaagcaaccacagcccgaatccgggacacacttcggcgagtgcttaacctacctcccaacaccattatggaatacaaaactcacaccgacagcatcaaaatgccaggcaggctgggcccccaaaggctcctttttcaaaacctctggaagccgcggttgaatgtgccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - ubiquitin protein ligase E3 component n-recognin 7 (putative) - SEC22 vesicle trafficking protein homolog A (S. cerevisiae) - poliovirus receptor related immunoglobulin domain containing |