SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene View larger

SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007122
Product type: DNA & cDNA
Ncbi symbol: SEC22A
Origin species: Human
Product name: SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC007122
Gene id: 26984
Gene description: SEC22 vesicle trafficking protein homolog A (S. cerevisiae)
Synonyms: vesicle-trafficking protein SEC22a; SEC22L2; SEC22 vesicle trafficking protein homolog A; SEC22 vesicle trafficking protein-like 2; sec22 homolog; SEC22 homolog A, vesicle trafficking protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctatgattttatctgcctcagtcattcgtgtcagagatggactgccactttctgcttctactgattatgaacaaagcacaggaatgcaggagtgcagaaagtattttaaaatgctttcgaggaaacttgctcaacttcctgatagatgtacactgaaaactggacattataacattaattttattagctctctgggagtgagctacatgatgttgtgcactgaaaattacccaaatgttctcgccttctctttcctggatgagcttcagaaggagttcattactacttataacatgatgaagacaaatactgctgtcagaccatactgtttcattgaatttgataacttcattcagaggaccaagcagcgatataataatcccaggtctctttcaacaaagataaatctttctgacatgcagacggaaatcaagctgaggcctccttatcaaatttccatgtgcgaactggggtcagccaatggagtcacatcagcattttctgttgactgtaaaggtgctggtaagatttcttctgctcaccagcgactggaaccagcaactctgtcagggattgtaggatttatccttagtcttttatgtggagctctgaatttaattcgaggctttcatgctatagaaagtctcctgcagagtgatggtgatgattttaattacatcattgcatttttccttggaacagcagcctgcctttaccagtgttatttacttgtctactacaccggctggcggaatgtcaaatcttttttgacttttggcttaatctgtctatgcaacatgtatctctatgaactgcgcaacctctggcagcttttctttcatgtgactgtgggagcatttgttacactacagatctggctaaggcaagcccagggcaaggctcccgattatgatgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poliovirus receptor related immunoglobulin domain containing
- protein kinase, cAMP-dependent, regulatory, type II, alpha
- protein phosphatase 1, regulatory (inhibitor) subunit 12B
- sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)

Buy SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene now

Add to cart