Login to display prices
Login to display prices
SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene View larger

SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene

PTXBC007122

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene

Proteogenix catalog: PTXBC007122
Ncbi symbol: SEC22A
Product name: SEC22A-SEC22 vesicle trafficking protein homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC007122
Gene id: 26984
Gene description: SEC22 vesicle trafficking protein homolog A (S. cerevisiae)
Synonyms: vesicle-trafficking protein SEC22a; SEC22L2; SEC22 vesicle trafficking protein homolog A; SEC22 vesicle trafficking protein-like 2; sec22 homolog; SEC22 homolog A, vesicle trafficking protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctatgattttatctgcctcagtcattcgtgtcagagatggactgccactttctgcttctactgattatgaacaaagcacaggaatgcaggagtgcagaaagtattttaaaatgctttcgaggaaacttgctcaacttcctgatagatgtacactgaaaactggacattataacattaattttattagctctctgggagtgagctacatgatgttgtgcactgaaaattacccaaatgttctcgccttctctttcctggatgagcttcagaaggagttcattactacttataacatgatgaagacaaatactgctgtcagaccatactgtttcattgaatttgataacttcattcagaggaccaagcagcgatataataatcccaggtctctttcaacaaagataaatctttctgacatgcagacggaaatcaagctgaggcctccttatcaaatttccatgtgcgaactggggtcagccaatggagtcacatcagcattttctgttgactgtaaaggtgctggtaagatttcttctgctcaccagcgactggaaccagcaactctgtcagggattgtaggatttatccttagtcttttatgtggagctctgaatttaattcgaggctttcatgctatagaaagtctcctgcagagtgatggtgatgattttaattacatcattgcatttttccttggaacagcagcctgcctttaccagtgttatttacttgtctactacaccggctggcggaatgtcaaatcttttttgacttttggcttaatctgtctatgcaacatgtatctctatgaactgcgcaacctctggcagcttttctttcatgtgactgtgggagcatttgttacactacagatctggctaaggcaagcccagggcaaggctcccgattatgatgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: