Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRKAR2A-protein kinase, cAMP-dependent, regulatory, type II, alpha Gene
PTXBC002763
New product
Data sheet of PRKAR2A-protein kinase, cAMP-dependent, regulatory, type II, alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRKAR2A-protein kinase, cAMP-dependent, regulatory, type II, alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002763 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRKAR2A |
| Origin species: | Human |
| Product name: | PRKAR2A-protein kinase, cAMP-dependent, regulatory, type II, alpha Gene |
| Size: | 2ug |
| Accessions: | BC002763 |
| Gene id: | 5576 |
| Gene description: | protein kinase, cAMP-dependent, regulatory, type II, alpha |
| Synonyms: | PKR2; PRKAR2; cAMP-dependent protein kinase type II-alpha regulatory subunit; cAMP-dependent protein kinase regulatory subunit RII alpha; protein kinase A, RII-alpha subunit; protein kinase, cAMP-dependent, regulatory subunit type II alpha; protein kinase cAMP-dependent type II regulatory subunit alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccacatccagatcccgccggggctcacggagctgctgcagggctacacggtggaggtgctgcgacagcagccgcctgacctcgtcgaattcgcagtggagtacttcacccgcctgcgcgaggcccgcgccccagcctcagtcctgcccgccgccaccccacgccagagcctgggccaccccccgccagaacccggcccggaccgtgtcgccgacgccaaaggggacagcgagtcggaggaggacgaggacttggaagttccagttcctagcagatttaatagacgagtatcagtctgtgctgagacctataaccctgatgaggaagaggaagatacagatccaagggtgattcatcctaaaactgatgaacagagatgcagacttcaggaagcttgcaaagatattctccttttcaaaaatcttgatcaggaacagctttctcaagttctcgatgccatgtttgaaaggatagtcaaagctgatgagcatgtcattgaccaaggagatgatggagacaacttttatgtcatagaacggggaacttatgacattttagtaacaaaagataatcaaacccgctctgttggtcaatatgacaaccgtggcagttttggagaactagctctgatgtacaacaccccgagagctgctaccattgttgctacctcagaaggctccctttggggactggaccgggtgacttttagaagaatcatagtgaaaaataatgcaaagaagaggaagatgtttgaatcatttattgagtctgtgcccctccttaaatcactagaggtgtcagaacgaatgaagattgtggatgtaataggagagaagatctataaggatggagaacgcataatcactcagactaaatcaaacaaggatggtgggaaccaggaggtcgagattgcccgctgccataaggggcagtactttggagagcttgccctggtcaccaacaaacccagagctgcctcagcttatgcagttggagatgtcaaatgcttagttatggatgtacaagcattcgagaggcttctggggccctgcatggacatcatgaagaggaacatctcacactatgaggaacagctggtgaagatgtttggctccagcgtggatctgggcaacctcgggcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1, regulatory (inhibitor) subunit 12B - sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) - serpin peptidase inhibitor, clade B (ovalbumin), member 4 - proline-serine-threonine phosphatase interacting protein 1 |