SERPINB4-serpin peptidase inhibitor, clade B (ovalbumin), member 4 Gene View larger

SERPINB4-serpin peptidase inhibitor, clade B (ovalbumin), member 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINB4-serpin peptidase inhibitor, clade B (ovalbumin), member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINB4-serpin peptidase inhibitor, clade B (ovalbumin), member 4 Gene

Proteogenix catalog: PTXBC017401
Ncbi symbol: SERPINB4
Product name: SERPINB4-serpin peptidase inhibitor, clade B (ovalbumin), member 4 Gene
Size: 2ug
Accessions: BC017401
Gene id: 6318
Gene description: serpin peptidase inhibitor, clade B (ovalbumin), member 4
Synonyms: LEUPIN; PI11; SCCA-2; SCCA1; SCCA2; serpin B4; SCCA2/SCCA1 fusion protein; peptidase inhibitor 11; protease inhibitor (leucine-serpin); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4; serpin peptidase inhibitor, clade B (ovalbumin), member 4; squamous cell carcinoma antigen 1; squamous cell carcinoma antigen 2; serpin family B member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattcactcagtgaagccaacaccaagttcatgttcgatctgttccaacagttcagaaaatcaaaagagaacaacatcttctattcccctatcagcatcacatcagcattagggatggtcctcttaggagccaaagacaacactgcacaacaaattagcaaggttcttcactttgatcaagtcacagagaacaccacagaaaaagctgcaacatatcatgttgataggtcaggaaatgttcatcaccagtttcaaaagcttctgactgaattcaacaaatccactgatgcatatgagctgaagatcgccaacaagctcttcggagaaaagacgtatcaatttttacaggaatatttagatgccatcaagaaattttaccagaccagtgtggaatctactgattttgcaaatgctccagaagaaagtcgaaagaagattaactcctgggtggaaagtcaaacgaatgaaaaaattaaaaacctatttcctgatgggactattggcaatgatacgacactggttcttgtgaacgcaatctatttcaaagggcagtgggagaataaatttaaaaaagaaaacactaaagaggaaaaattttggccaaacaagaatacatacaaatctgtacagatgatgaggcaatacaattcctttaattttgccttgctggaggatgtacaggccaaggtcctggaaataccatacaaaggcaaagatctaagcatgattgtgctgctgccaaatgaaatcgatggtctgcagaagcttgaagagaaactcactgctgagaaattgatggaatggacaagtttgcagaatatgagagagacatgtgtcgatttacacttacctcggttcaaaatggaagagagctatgacctcaaggacacgttgagaaccatgggaatggtgaatatcttcaatggggatgcagacctctcaggcatgacctggagccacggtctctcagtatctaaagtcctacacaaggcctttgtggaggtcactgaggagggagtggaagctgcagctgccaccgctgtagtagtagtcgaattatcatctccttcaactaatgaagagttctgttgtaatcaccctttcctattcttcataaggcaaaataagaccaacagcatcctcttctatggcagattctcatccccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice