CAMKK1-calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene View larger

CAMKK1-calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene

PTXBC031647

New product

Data sheet of CAMKK1-calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CAMKK1-calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC031647
Product type: DNA & cDNA
Ncbi symbol: CAMKK1
Origin species: Human
Product name: CAMKK1-calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene
Size: 2ug
Accessions: BC031647
Gene id: 84254
Gene description: calcium/calmodulin-dependent protein kinase kinase 1, alpha
Synonyms: CAMKKA; calcium/calmodulin-dependent protein kinase kinase 1; CAMKK alpha protein; caM-KK 1; caM-KK alpha; caM-kinase IV kinase; caM-kinase kinase 1; caM-kinase kinase alpha; caMKK 1; calcium/calmodulin-dependent protein kinase kinase 1, alpha; calcium/calmodulin-dependent protein kinase kinase alpha; calcium/calmodulin dependent protein kinase kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggggggtccagctgtctgctgccaggatcctcgggcagagctggtagaacgggtggcagccatcgatgtgactcacttggaggaggcagatggtggcccagagcctactagaaacggtgtggaccccccaccacgggccagagctgcctctgtgatccctggcagtacttcaagactgctcccagcccggcctagcctctcagccaggaagctttccctacaggagcggccagcaggaagctatctggaggcgcaggctgggccttatgccacggggcctgccagccacatctccccccgggcctggcggaggcccaccatcgagtcccaccacgtggccatctcagatgcagaggactgcgtgcagctgaaccagtacaagctgcagagtgagattggcaagggtgcctacggtgtggtgaggctggcctacaacgaaagtgaagacagacactatgcaatgaaagtcctttccaaaaagaagttactgaagcagtatggctttccacgtcgccctcccccgagagggtcccaggctgcccagggaggaccagccaagcagctgctgcccctggagcgggtgtaccaggagattgccatcctgaagaagctggaccacgtgaatgtggtcaaactgatcgaggtcctggatgacccagctgaggacaacctctatttggccctgcagaaccaggcccagaatatccagttagattcaacaaatatcgccaagccccactccctgcttccctctgagcagcaagacagtggatccacgtgggctgcgcgctcagtgtttgacctcctgagaaaggggcccgtcatggaagtgccctgtgacaagcccttctcggaggagcaagctcgcctctacctgcgggacgtcatcctgggcctcgagtacttgcactgccagaagatcgtccacagggacatcaagccatccaacctgctcctgggggatgatgggcacgtgaagatcgccgactttggcgtcagcaaccagtttgaggggaacgacgctcagctgtccagcacggcgggaaccccagcattcatggcccccgaggccatttctgattccggccagagcttcagtgggaaggccttggatgtatgggccactggcgtcacgttgtactgctttgtctatgggaagtgcccgttcatcgacgatttcatcctggccctccacaggaagatcaagaatgagcccgtggtgtttcctgaggggccagaaatcagcgaggagctcaaggacctgatcctgaagatgttagacaagaatcccgagacgagaattggggtgccagacatcaagttgcacccttgggtgaccaagaacggggaggagccccttccttcggaggaggagcactgcagcgtggtggaggtgacagaggaggaggttaagaactcagtcaggctcatccccagctggaccacggtgatcctggtgaagtccatgctgaggaagcgttcctttgggaacccgtttgagccccaagcacggagggaagagcgatccatgtctgctccaggaaacctactggtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synaptotagmin binding, cytoplasmic RNA interacting protein
- protein phosphatase 1, regulatory (inhibitor) subunit 16A
- chondroitin sulfate N-acetylgalactosaminyltransferase 2
- EGF, latrophilin and seven transmembrane domain containing 1

Buy CAMKK1-calcium/calmodulin-dependent protein kinase kinase 1, alpha Gene now

Add to cart