PPP1R16A-protein phosphatase 1, regulatory (inhibitor) subunit 16A Gene View larger

PPP1R16A-protein phosphatase 1, regulatory (inhibitor) subunit 16A Gene


New product

Data sheet of PPP1R16A-protein phosphatase 1, regulatory (inhibitor) subunit 16A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1R16A-protein phosphatase 1, regulatory (inhibitor) subunit 16A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007854
Product type: DNA & cDNA
Ncbi symbol: PPP1R16A
Origin species: Human
Product name: PPP1R16A-protein phosphatase 1, regulatory (inhibitor) subunit 16A Gene
Size: 2ug
Accessions: BC007854
Gene id: 84988
Gene description: protein phosphatase 1, regulatory (inhibitor) subunit 16A
Synonyms: protein phosphatase 1 regulatory subunit 16A; myosin phosphatase-targeting subunit 3; protein phosphatase 1, regulatory (inhibitor) subunit 16A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgagcacctggagctgctggcagagatgcccatggtgggcaggatgagcacacaggagcggctgaagcatgcccagaagcggcgcgcccagcaggtgaagatgtgggcccaggctgagaaggaggcccagggcaagaagggtcctggggagcgtccccggaaggaggcagccagccaagggctcctgaagcaggtcctcttccctcccagtgttgtccttctggaggccgctgcccgaaatgacctggaagaagtccgccagttccttgggagtggggtcagccctgacttggccaacgaggacggcctgacggccctgcaccagtgctgcattgatgatttccgagagatggtgcagcagctcctggaggctggggccaacatcaatgcctgtgacagtgagtgctggacgcctctgcatgctgcggccacctgcggccacctgcacctggtggagctgctcatcgccagtggcgccaatctcctggcggtcaacaccgacgggaacatgccctatgacctgtgtgatgatgagcagacgctggactgcctggagactgccatggccgaccgtggcatcacccaggacagcatcgaggccgcccgggccgtgccagaactgcgcatgctggacgacatccggagccggctgcaggccggggcagacctccatgcccccctggaccacggggccacgctgctgcacgtcgcagccgccaacgggttcagcgaggcggctgccctgctgctggaacaccgagccagcctgagcgctaaggaccaagacggctgggagccgctgcacgccgcggcctactggggccaggtgcccctggtggagctgctcgtggcgcacggggccgacctgaacgcaaagtccctgatggacgagacgccccttgatgtgtgcggggacgaggaggtgcgggccaagctgctggagctgaagcacaagcacgacgccctcctgcgcgcccagagccgccagcgctccttgctgcgccgccgcacctccagcgccggcagccgcgggaaggtggtgaggcgggtgagcctaacccagcgcaccgacctgtaccgcaagcagcacgcccaggaggccatcgtgtggcaacagccgccgcccaccagcccggagccgcccgaggacaacgatgaccgccagacaggcgcagagctcaggccgccgcccccggaggaggacaaccccgaagtggtcaggccgcacaatggccgagtagggggctccccagtgcggcatctatactccaagcgactagaccggagtgtctcctaccagctgagccccctggacagcaccaccccccacaccctggtccacgacaaggcccaccacaccctggctgacctgaagcgccagcgagctgctgccaagctgcagcgacccccacctgaggggcccgagagccctgagacagctgagcctggcctgcctggtgacacggtgaccccccagcctgactgtggcttcagggcaggcggggacccacccctgctcaagctcacagccccggcggtggaggctcccgtggagaggaggccgtgctgcctgctcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chondroitin sulfate N-acetylgalactosaminyltransferase 2
- EGF, latrophilin and seven transmembrane domain containing 1
- NDC80 homolog, kinetochore complex component (S. cerevisiae)
- solute carrier family 20 (phosphate transporter), member 2

Buy PPP1R16A-protein phosphatase 1, regulatory (inhibitor) subunit 16A Gene now

Add to cart