NDC80-NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene View larger

NDC80-NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene


New product

Data sheet of NDC80-NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDC80-NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035617
Product type: DNA & cDNA
Ncbi symbol: NDC80
Origin species: Human
Product name: NDC80-NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene
Size: 2ug
Accessions: BC035617
Gene id: 10403
Gene description: NDC80 homolog, kinetochore complex component (S. cerevisiae)
Synonyms: NDC80, kinetochore complex component; NDC80 kinetochore complex component homolog; NDC80 homolog, kinetochore complex component; kinetochore protein NDC80 homolog; HEC; HEC1; HsHec1; KNTC2; TID3; hsNDC80; highly expressed in cancer protein; highly expressed in cancer, rich in leucine heptad repeats; kinetochore associated 2; kinetochore protein Hec1; kinetochore-associated protein 2; retinoblastoma-associated protein HEC
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcgcagttcagtttccagcggtggtgctggccgcctctccatgcaggagttaagatcccaggatgtaaataaacaaggcctctatacccctcaaaccaaagagaaaccaacctttggaaagttgagtataaacaaaccgacatctgaaagaaaagtctcgctatttggcaaaagaactagtggacatggatcccggaatagtcaacttggtatattttccagttctgagaaaatcaaggacccgagaccacttaatgacaaagcattcattcagcagtgtattcgacaactctgtgagtttcttacagaaaatggttatgcacataatgtgtccatgaaatctctacaagctccctctgttaaagacttcctgaagatcttcacatttctttatggcttcctgtgcccctcatacgaacttcctgacacaaagtttgaagaagaggttccaagaatctttaaagaccttgggtatccttttgcactatccaaaagctccatgtacacagtgggggctcctcatacatggcctcacattgtggcagccttagtttggctaatagactgcatcaagatacatactgccatgaaagaaagctcacctttatttgatgatgggcagccttggggagaagaaactgaagatggaattatgcataataagttgtttttggactacaccataaaatgctatgagagttttatgagtggtgccgacagctttgatgagatgaatgcagagctgcagtcaaaactgaaggatttatttaatgtggatgcttttaagctggaatcattagaagcaaaaaacagagcattgaatgaacagattgcaagattggaacaagaaagagaaaaagaaccgaatcgtctagagtcgttgagaaaactgaaggcttccttacaaggagatgttcaaaagtatcaggcatacatgagcaatttggagtctcattcagccattcttgaccagaaattaaatggtctcaatgaggaaattgctagagtagaactagaatgtgaaacaataaaacaggagaacactcgactacagaatatcattgacaaccagaagtactcagttgcagacattgagcgaataaatcatgaaagaaatgaattgcagcagactattaataaattaaccaaggacctggaagctgaacaacagaagttgtggaatgaggagttaaaatatgccagaggcaaagaagcgattgaaacacaattagcagagtatcacaaattggctagaaaattaaaacttattcctaaaggtgctgagaattccaaaggttatgactttgaaattaagtttaatcccgaggctggtgccaactgccttgtcaaatacagggctcaagtttatgtacctcttaaggaactcctgaatgaaactgaagaagaaattaataaagccctaaataaaaaaatgggtttggaggatactttagaacaattgaatgcaatgataacagaaagcaagagaagtgtgagaactctgaaagaagaagttcaaaagctggatgatctttaccaacaaaaaattaaggaagcagaggaagaggatgaaaaatgtgccagtgagcttgagtccttggagaaacacaagcacctgctagaaagtactgttaaccaggggctcagtgaagctatgaatgaattagatgctgttcagcgggaataccaactagttgtgcaaaccacgactgaagaaagacgaaaagtgggaaataacttgcaacgtctgttagagatggttgctacacatgttgggtctgtagagaaacatcttgaggagcagattgctaaagttgatagagaatatgaagaatgcatgtcagaagatctctcggaaaatattaaagagattagagataagtatgagaagaaagctactctaattaagtcttctgaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 20 (phosphate transporter), member 2
- solute carrier family 20 (phosphate transporter), member 1
- RAS guanyl releasing protein 3 (calcium and DAG-regulated)
- budding uninhibited by benzimidazoles 1 homolog beta (yeast)

Buy NDC80-NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene now

Add to cart