SLC20A2-solute carrier family 20 (phosphate transporter), member 2 Gene View larger

SLC20A2-solute carrier family 20 (phosphate transporter), member 2 Gene


New product

Data sheet of SLC20A2-solute carrier family 20 (phosphate transporter), member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC20A2-solute carrier family 20 (phosphate transporter), member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028600
Product type: DNA & cDNA
Ncbi symbol: SLC20A2
Origin species: Human
Product name: SLC20A2-solute carrier family 20 (phosphate transporter), member 2 Gene
Size: 2ug
Accessions: BC028600
Gene id: 6575
Gene description: solute carrier family 20 (phosphate transporter), member 2
Synonyms: GLVR-2; GLVR2; IBGC1; IBGC3; MLVAR; PIT-2; PIT2; RAM1; Ram-1; sodium-dependent phosphate transporter 2; gibbon ape leukemia virus receptor 2; murine leukemia virus, amphotropic, receptor for; murine leukemia virus, amphotropic; receptor; solute carrier family 20 (phosphate transporter), member 2; solute carrier family 20 member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatggatgagtatttgtggatggtcattttgggtttcatcatagctttcatcttggccttttctgttggtgcaaacgatgttgccaactcctttggtacagccgtgggctctggtgtggtgaccttgaggcaggcatgcattttagcttcaatatttgaaaccaccggctccgtgttactaggcgccaaagtaggagaaaccattcgcaaaggtatcattgacgtgaacctgtacaacgagacggtggagactctcatggctggggaagttagtgccatggttggttccgctgtgtggcagctgattgcttccttcctgaggcttccaatctcaggaacgcactgcattgtgggttctactataggattctcactggtcgcaatcggtaccaaaggtgtgcagtggatggagcttgtcaagattgttgcttcttggtttatatctccactgttgtctggtttcatgtctggcctgctgtttgtactcatcagaattttcatcttaaaaaaggaagaccctgttcccaatggcctccgggcactcccagtattctatgctgctaccatagcaatcaatgtcttttccatcatgtacacaggagcaccagtgctcggccttgttctccccatgtgggccatagccctcatttcctttggtgtcgccctcctgttcgctttttttgtgtggctcttcgtgtgtccgtggatgcggaggaaaataacaggcaaattacaaaaagaaggtgctttatcacgagtatctgacgaaagcctcagtaaggttcaggaagcagagtccccagtatttaaagagctaccaggtgccaaggctaatgatgacagcaccatcccgctcacgggagcagcaggggagacactggggacctcggaaggcacttctgcgggcagccaccctcgggctgcatacggaagagcactgtccatgacccatggctctgtgaaatcgcccatctccaacggcaccttcggcttcgacggccacaccaggagcgacggtcatgtgtaccacaccgtgcacaaagactcggggctctacaaagatctgctgcacaaaatccacatcgacaggggccccgaggagaagccagcccaggaaagcaactaccggctgctgcgccgaaacaacagttacacctgctacaccgcagccatttgtgggctgccagtgcacgccacctttcgagctgcggactcatcggccccagaggacagtgagaagctggtgggcgacaccgtgtcctactccaagaagaggctgcgctacgacagctactcgagctactgtaacgcggtggcagaggcggagatcgaggcggaggagggcggcgtggagatgaagctggcgtcggagctggccgaccctgaccagccgcgagaggaccctgcagaggaggagaaggaggagaaggacgcacccgaggttcacctcctgttccatttcctgcaggtcctcaccgcctgtttcgggtcctttgctcacggcggcaatgacgtgagtaatgccatcggtcccctggtagccttgtggctgatttacaaacaaggcggggtaacgcaagaagcagctacacccgtctggctgctgttttatggaggagttggaatctgcacaggcctctgggtctgggggagaagagtgatccagaccatggggaaggacctcactcccatcacgccgtccagcggcttcacgatcgagctggcctcagccttcacagtggtgatcgcctccaacatcgggcttccagtcagcaccacgcactgtaaggtgggctcggtggtggccgtgggctggatccgctcccgcaaggctgtggactggcgcctctttcggaacatcttcgtggcctggttcgtgaccgtccctgtggctgggctgttcagcgctgctgtcatggctcttctcatgtatgggatccttccatatgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 20 (phosphate transporter), member 1
- RAS guanyl releasing protein 3 (calcium and DAG-regulated)
- budding uninhibited by benzimidazoles 1 homolog beta (yeast)
- polymerase (DNA directed), delta 1, catalytic subunit 125kDa

Buy SLC20A2-solute carrier family 20 (phosphate transporter), member 2 Gene now

Add to cart