Login to display prices
Login to display prices
SYNCRIP-synaptotagmin binding, cytoplasmic RNA interacting protein Gene View larger

SYNCRIP-synaptotagmin binding, cytoplasmic RNA interacting protein Gene


New product

Data sheet of SYNCRIP-synaptotagmin binding, cytoplasmic RNA interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SYNCRIP-synaptotagmin binding, cytoplasmic RNA interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032643
Product type: DNA & cDNA
Ncbi symbol: SYNCRIP
Origin species: Human
Product name: SYNCRIP-synaptotagmin binding, cytoplasmic RNA interacting protein Gene
Size: 2ug
Accessions: BC032643
Gene id: 10492
Gene description: synaptotagmin binding, cytoplasmic RNA interacting protein
Synonyms: GRY-RBP; GRYRBP; HNRNPQ; HNRPQ1; NSAP1; PP68; hnRNP-Q; heterogeneous nuclear ribonucleoprotein Q; NS1-associated protein 1; glycine- and tyrosine-rich RNA-binding protein; synaptotagmin binding cytoplasmic RNA interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctacagaacatgttaatggaaatggtactgaagagcccatggatactacttctgcagttatccattcagaaaattttcagacattgcttgatgctggtttaccacagaaagttgctgaaaaactagatgaaatttacgttgcagggctagttgcacatagtgatttagatgaaagagctattgaagctttaaaagaattcaatgaagacggtgcattggcagttcttcaacagtttaaagacagtgatctctctcatgttcagaacaaaagtgcctttttatgtggagtcatgaagacttacaggcagagagaaaaacaagggaccaaagtagcagattctagtaaaggaccagatgaggcaaaaattaaggcactcttggaaagaacaggctacacacttgatgtgaccactggacagaggaagtatggaggaccacctccagattccgtttattcaggtcagcagccttctgttggcactgagatatttgtgggaaagatcccaagagatctatttgaggatgaacttgttccattatttgagaaagctggacctatatgggatcttcgtctaatgatggatccactcactggtctcaatagaggttatgcgtttgtcactttttgtacaaaagaagcagctcaggaggctgttaaactgtataataatcatgaaattcgttctggaaaacatattggtgtctgcatctcagttgccaacaataggctttttgtgggctctattcctaagagtaaaaccaaggaacagattcttgaagaatttagcaaagtaacagagggtcttacagacgtcattttataccaccaaccggatgacaagaaaaaaaacagaggcttttgctttcttgaatatgaagatcacaaaacagctgcccaggtaaaagtgctgtttgtacgcaaccttgccaatactgtaacagaagagattttagaaaaggcatttagtcagtttgggaaactggaacgagtgaagaagttaaaagattatgcgttcattcattttgatgagcgagatggtgctgtcaaggctatggaagaaatgaatggcaaagacttggagggagaaaatattgaaattgtttttgccaagccaccagatcagaaaaggaaagaaagaaaagctcagaggcaagcagcaaaaaatcaaatgtatgacgattactactattatggtccacctcatatgccccctccaacaagaggtcgagggcgtggaggtagaggtggttatggatatcctccagattattatggatatgaagattattatgattattatggttatgattaccataactatcgtggtggatatgaagatccatactatggttatgaagattttcaagttggagctagaggaaggggtggtagaggagcaaggggtgctgctccatccagaggtcgtggggctgctcctccccgcggtagagccggttattcacagagaggaggtcctggatcagcaagaggcgttcgaggtgcgagaggaggtgcccaacaacaaagaggccgcgggcagggaaaaggggtcgaggccggtcctgacctgttacaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1, regulatory (inhibitor) subunit 16A
- chondroitin sulfate N-acetylgalactosaminyltransferase 2
- EGF, latrophilin and seven transmembrane domain containing 1
- NDC80 homolog, kinetochore complex component (S. cerevisiae)